Incidental Mutation 'R0497:Med13'
ID40552
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R0497 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 86276983 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably benign
Transcript: ENSMUST00000043624
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R8062:Med13 UTSW 11 86319438 missense probably benign
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGCAACACTTCTGAGGTAGAAGC -3'
(R):5'- TCTGTGGCTAGTGGCACAATACTTG -3'

Sequencing Primer
(F):5'- ggatgaatggattgacagatgg -3'
(R):5'- gctcacaataatccttccccc -3'
Posted On2013-05-23