Incidental Mutation 'R0497:Med13'
ID 40552
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Name mediator complex subunit 13
Synonyms 1110067M05Rik, Thrap1, Trap240
MMRRC Submission 038693-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R0497 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86157859-86248422 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 86167809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
AlphaFold Q5SWW4
Predicted Effect probably benign
Transcript: ENSMUST00000043624
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A C 11: 119,909,606 (GRCm39) V110G probably damaging Het
Adcy6 A C 15: 98,495,606 (GRCm39) probably null Het
Adm A G 7: 110,228,328 (GRCm39) T170A probably benign Het
Afap1l2 G T 19: 56,918,641 (GRCm39) N171K probably benign Het
Aph1b G T 9: 66,697,900 (GRCm39) S112* probably null Het
Arhgap23 A G 11: 97,342,989 (GRCm39) S424G probably damaging Het
Asah2 T A 19: 32,032,031 (GRCm39) N46I probably benign Het
Braf G A 6: 39,617,483 (GRCm39) probably benign Het
Brd2 C T 17: 34,333,334 (GRCm39) R47Q probably damaging Het
C2cd5 A G 6: 142,957,819 (GRCm39) V972A probably benign Het
Car9 T A 4: 43,511,881 (GRCm39) L300H probably damaging Het
Chmp3 T C 6: 71,529,395 (GRCm39) S20P probably damaging Het
Chp1 A G 2: 119,402,263 (GRCm39) N79S possibly damaging Het
Cnot2 A T 10: 116,334,260 (GRCm39) I335N probably damaging Het
Cntnap4 T C 8: 113,296,783 (GRCm39) V6A probably benign Het
Ctcf T A 8: 106,401,672 (GRCm39) probably benign Het
Dennd1b A G 1: 138,967,724 (GRCm39) probably benign Het
Dnmbp A G 19: 43,845,079 (GRCm39) probably benign Het
Eef2 T C 10: 81,017,420 (GRCm39) F782L probably benign Het
Eogt T A 6: 97,112,194 (GRCm39) Y153F probably benign Het
Fam81a G T 9: 70,003,401 (GRCm39) Q237K possibly damaging Het
Fat2 T A 11: 55,174,228 (GRCm39) T2162S probably benign Het
Fcgbpl1 T A 7: 27,846,890 (GRCm39) C1158S probably damaging Het
Gas6 T C 8: 13,520,387 (GRCm39) I434V possibly damaging Het
Gm42417 A T 1: 36,571,248 (GRCm39) L77Q probably damaging Het
Grik3 A T 4: 125,517,303 (GRCm39) N49Y possibly damaging Het
Gucy2e A T 11: 69,114,985 (GRCm39) V974E probably damaging Het
Helz2 A G 2: 180,871,449 (GRCm39) V2721A probably damaging Het
Klhl6 GT G 16: 19,775,716 (GRCm39) 279 probably null Het
Krt73 A G 15: 101,710,665 (GRCm39) L23P probably damaging Het
L3mbtl3 T C 10: 26,158,772 (GRCm39) probably benign Het
Lrrc15 A T 16: 30,091,710 (GRCm39) V543E probably damaging Het
Med25 T C 7: 44,541,524 (GRCm39) D60G probably damaging Het
Mgam T A 6: 40,641,826 (GRCm39) Y560N probably damaging Het
Mlkl A G 8: 112,054,505 (GRCm39) Y211H probably damaging Het
Msl2 A G 9: 100,978,493 (GRCm39) N289S probably benign Het
Nwd2 G T 5: 63,963,686 (GRCm39) W1090L probably damaging Het
Omt2b T C 9: 78,235,513 (GRCm39) probably benign Het
Or4k37 A G 2: 111,159,175 (GRCm39) D137G probably benign Het
Pald1 A G 10: 61,177,094 (GRCm39) L652P probably damaging Het
Pard3b T A 1: 62,479,167 (GRCm39) probably null Het
Prdm15 G A 16: 97,595,534 (GRCm39) T1098I possibly damaging Het
Rock2 A G 12: 17,004,954 (GRCm39) T436A probably benign Het
Sema4c A T 1: 36,588,689 (GRCm39) D812E probably benign Het
Sla A T 15: 66,664,098 (GRCm39) I91K probably benign Het
Slc22a16 T G 10: 40,460,963 (GRCm39) M255R probably damaging Het
Slc49a4 A T 16: 35,555,974 (GRCm39) V162D probably benign Het
Smg8 C T 11: 86,976,910 (GRCm39) D224N possibly damaging Het
Spdef A T 17: 27,937,032 (GRCm39) D190E probably benign Het
Taok1 A G 11: 77,464,630 (GRCm39) I152T probably damaging Het
Tmem220 A G 11: 66,916,748 (GRCm39) D36G probably damaging Het
Tmem235 A C 11: 117,755,177 (GRCm39) I210L probably benign Het
Tmem266 C T 9: 55,288,168 (GRCm39) probably null Het
Tmprss12 A G 15: 100,178,920 (GRCm39) probably benign Het
Trim32 G A 4: 65,531,491 (GRCm39) R16Q probably damaging Het
Usp38 T A 8: 81,711,053 (GRCm39) probably benign Het
Usp44 C T 10: 93,682,668 (GRCm39) P373S possibly damaging Het
Vmn1r209 G T 13: 22,990,118 (GRCm39) Q191K probably damaging Het
Vmn1r70 T C 7: 10,367,953 (GRCm39) I147T probably benign Het
Vmn2r107 T A 17: 20,595,394 (GRCm39) I649N probably damaging Het
Vmn2r12 A T 5: 109,239,755 (GRCm39) Y269* probably null Het
Zan C T 5: 137,410,938 (GRCm39) probably benign Het
Zfp616 G T 11: 73,974,306 (GRCm39) V192L probably benign Het
Zfp644 A T 5: 106,786,199 (GRCm39) V116D probably damaging Het
Zgrf1 T C 3: 127,378,299 (GRCm39) probably benign Het
Zhx3 A T 2: 160,621,914 (GRCm39) L751* probably null Het
Znfx1 T A 2: 166,897,331 (GRCm39) Q531L probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86,181,866 (GRCm39) splice site probably benign
IGL01391:Med13 APN 11 86,219,323 (GRCm39) missense probably benign
IGL01767:Med13 APN 11 86,210,609 (GRCm39) missense probably benign 0.38
IGL01830:Med13 APN 11 86,179,754 (GRCm39) splice site probably benign
IGL01859:Med13 APN 11 86,174,577 (GRCm39) missense possibly damaging 0.86
IGL01924:Med13 APN 11 86,199,522 (GRCm39) splice site probably benign
IGL02080:Med13 APN 11 86,174,638 (GRCm39) missense probably damaging 0.97
IGL02138:Med13 APN 11 86,177,591 (GRCm39) missense probably damaging 0.99
IGL02259:Med13 APN 11 86,248,327 (GRCm39) missense possibly damaging 0.89
IGL02339:Med13 APN 11 86,179,765 (GRCm39) missense probably benign 0.16
IGL02399:Med13 APN 11 86,174,771 (GRCm39) splice site probably benign
IGL02646:Med13 APN 11 86,174,212 (GRCm39) missense probably benign 0.00
IGL03227:Med13 APN 11 86,218,618 (GRCm39) splice site probably benign
R0197_Med13_854 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0360_Med13_060 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R2359_Med13_079 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R3735_Med13_085 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4974_Med13_508 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R0116:Med13 UTSW 11 86,210,723 (GRCm39) missense probably damaging 0.99
R0189:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R0197:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0206:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0208:Med13 UTSW 11 86,191,682 (GRCm39) splice site probably benign
R0310:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R0360:Med13 UTSW 11 86,219,987 (GRCm39) splice site probably benign
R0413:Med13 UTSW 11 86,190,033 (GRCm39) splice site probably benign
R0482:Med13 UTSW 11 86,175,977 (GRCm39) missense probably benign 0.41
R0589:Med13 UTSW 11 86,174,075 (GRCm39) missense probably damaging 1.00
R0601:Med13 UTSW 11 86,236,788 (GRCm39) missense possibly damaging 0.47
R0646:Med13 UTSW 11 86,221,915 (GRCm39) missense possibly damaging 0.95
R0701:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R0709:Med13 UTSW 11 86,210,422 (GRCm39) missense possibly damaging 0.95
R0711:Med13 UTSW 11 86,192,179 (GRCm39) splice site probably benign
R0734:Med13 UTSW 11 86,192,063 (GRCm39) missense probably benign
R0883:Med13 UTSW 11 86,197,864 (GRCm39) missense probably benign 0.13
R1793:Med13 UTSW 11 86,220,177 (GRCm39) missense probably benign 0.45
R1926:Med13 UTSW 11 86,179,899 (GRCm39) missense possibly damaging 0.47
R1959:Med13 UTSW 11 86,189,805 (GRCm39) missense probably damaging 1.00
R2286:Med13 UTSW 11 86,210,515 (GRCm39) missense probably benign 0.05
R2359:Med13 UTSW 11 86,181,861 (GRCm39) splice site probably benign
R2444:Med13 UTSW 11 86,222,786 (GRCm39) missense probably damaging 1.00
R2679:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R2879:Med13 UTSW 11 86,189,988 (GRCm39) missense possibly damaging 0.61
R3439:Med13 UTSW 11 86,176,123 (GRCm39) missense probably damaging 1.00
R3735:Med13 UTSW 11 86,170,484 (GRCm39) missense probably benign 0.00
R4333:Med13 UTSW 11 86,179,009 (GRCm39) missense probably benign
R4558:Med13 UTSW 11 86,189,880 (GRCm39) missense probably damaging 1.00
R4598:Med13 UTSW 11 86,169,392 (GRCm39) missense probably damaging 0.97
R4773:Med13 UTSW 11 86,167,746 (GRCm39) missense probably damaging 0.99
R4801:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4802:Med13 UTSW 11 86,169,599 (GRCm39) missense probably damaging 1.00
R4806:Med13 UTSW 11 86,189,403 (GRCm39) missense probably benign 0.00
R4940:Med13 UTSW 11 86,178,944 (GRCm39) missense probably damaging 1.00
R4974:Med13 UTSW 11 86,189,673 (GRCm39) missense probably damaging 0.98
R5056:Med13 UTSW 11 86,219,391 (GRCm39) missense probably benign 0.00
R5133:Med13 UTSW 11 86,210,675 (GRCm39) missense probably benign 0.32
R5206:Med13 UTSW 11 86,210,705 (GRCm39) missense probably damaging 1.00
R5352:Med13 UTSW 11 86,192,294 (GRCm39) missense possibly damaging 0.82
R5534:Med13 UTSW 11 86,210,191 (GRCm39) missense probably benign 0.09
R5556:Med13 UTSW 11 86,218,664 (GRCm39) missense probably benign 0.25
R5633:Med13 UTSW 11 86,169,757 (GRCm39) splice site probably benign
R5769:Med13 UTSW 11 86,236,829 (GRCm39) missense probably benign 0.11
R6236:Med13 UTSW 11 86,219,357 (GRCm39) missense probably damaging 0.99
R6479:Med13 UTSW 11 86,248,353 (GRCm39) start gained probably benign
R6487:Med13 UTSW 11 86,221,976 (GRCm39) missense probably damaging 1.00
R6524:Med13 UTSW 11 86,192,293 (GRCm39) missense probably damaging 0.98
R6528:Med13 UTSW 11 86,189,780 (GRCm39) missense probably damaging 1.00
R6805:Med13 UTSW 11 86,169,622 (GRCm39) missense possibly damaging 0.48
R6913:Med13 UTSW 11 86,210,702 (GRCm39) missense probably benign
R7221:Med13 UTSW 11 86,178,921 (GRCm39) missense probably benign 0.00
R7254:Med13 UTSW 11 86,210,661 (GRCm39) missense probably benign
R7267:Med13 UTSW 11 86,199,652 (GRCm39) missense probably benign 0.01
R7309:Med13 UTSW 11 86,181,888 (GRCm39) missense probably benign 0.00
R7404:Med13 UTSW 11 86,177,272 (GRCm39) missense possibly damaging 0.53
R7586:Med13 UTSW 11 86,161,828 (GRCm39) missense probably damaging 0.99
R7704:Med13 UTSW 11 86,236,744 (GRCm39) nonsense probably null
R7922:Med13 UTSW 11 86,161,831 (GRCm39) missense probably damaging 0.98
R7943:Med13 UTSW 11 86,169,352 (GRCm39) missense probably damaging 0.97
R8062:Med13 UTSW 11 86,210,264 (GRCm39) missense probably benign
R8075:Med13 UTSW 11 86,163,296 (GRCm39) missense probably damaging 0.98
R8207:Med13 UTSW 11 86,194,375 (GRCm39) missense probably damaging 1.00
R8671:Med13 UTSW 11 86,161,923 (GRCm39) missense probably damaging 1.00
R9056:Med13 UTSW 11 86,189,660 (GRCm39) nonsense probably null
R9084:Med13 UTSW 11 86,191,621 (GRCm39) missense probably damaging 1.00
R9148:Med13 UTSW 11 86,192,297 (GRCm39) missense probably benign 0.27
R9329:Med13 UTSW 11 86,189,283 (GRCm39) missense probably benign 0.10
R9380:Med13 UTSW 11 86,177,598 (GRCm39) missense probably benign 0.42
R9515:Med13 UTSW 11 86,199,727 (GRCm39) missense probably benign 0.00
R9516:Med13 UTSW 11 86,179,801 (GRCm39) missense probably benign 0.01
R9690:Med13 UTSW 11 86,169,670 (GRCm39) missense probably damaging 1.00
R9751:Med13 UTSW 11 86,189,984 (GRCm39) missense probably damaging 1.00
R9752:Med13 UTSW 11 86,174,147 (GRCm39) missense possibly damaging 0.87
R9764:Med13 UTSW 11 86,177,345 (GRCm39) missense possibly damaging 0.89
Z1176:Med13 UTSW 11 86,246,249 (GRCm39) missense probably damaging 1.00
Z1176:Med13 UTSW 11 86,236,688 (GRCm39) missense probably benign 0.45
Z1176:Med13 UTSW 11 86,219,370 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCGCAACACTTCTGAGGTAGAAGC -3'
(R):5'- TCTGTGGCTAGTGGCACAATACTTG -3'

Sequencing Primer
(F):5'- ggatgaatggattgacagatgg -3'
(R):5'- gctcacaataatccttccccc -3'
Posted On 2013-05-23