Incidental Mutation 'R5298:Trim45'
ID405521
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
MMRRC Submission 042881-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5298 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100925471 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 340 (D340G)
Ref Sequence ENSEMBL: ENSMUSP00000102593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect probably damaging
Transcript: ENSMUST00000037409
AA Change: D340G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233
AA Change: D340G

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094048
AA Change: D291G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233
AA Change: D291G

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106980
AA Change: D340G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233
AA Change: D340G

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134993
AA Change: D340G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: D340G

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,098,887 V287A possibly damaging Het
Adat2 A G 10: 13,556,906 N51D probably benign Het
Alms1-ps1 T C 6: 85,752,118 noncoding transcript Het
Ccdc97 A G 7: 25,716,007 V12A probably damaging Het
Cdcp2 T C 4: 107,106,985 V344A probably benign Het
Clasp1 A G 1: 118,547,920 D929G possibly damaging Het
Clip4 A G 17: 71,834,225 N525D probably damaging Het
Csde1 T A 3: 103,047,209 probably null Het
D330020A13Rik T C 6: 120,294,816 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam208b T C 13: 3,595,613 probably null Het
Fuca1 C A 4: 135,936,926 Y374* probably null Het
Gle1 C G 2: 29,948,943 P457A probably benign Het
Hadhb T C 5: 30,177,011 probably null Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lef1 A T 3: 131,194,667 R294S possibly damaging Het
Lrriq4 G T 3: 30,645,332 M1I probably null Het
Magi2 T C 5: 20,569,162 S884P probably damaging Het
Mon2 A G 10: 123,010,606 I1353T probably benign Het
Olfr1262 T A 2: 90,002,460 L18Q possibly damaging Het
Olfr510 A G 7: 108,668,072 I219V probably benign Het
Parg C A 14: 32,202,253 A3E probably damaging Het
Per3 A T 4: 151,029,209 D297E probably damaging Het
Pkhd1l1 A T 15: 44,504,046 Y780F probably benign Het
Plcg2 A G 8: 117,605,249 Y858C probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Qsox2 A C 2: 26,214,062 S484A probably damaging Het
Reep4 G A 14: 70,548,197 G225D possibly damaging Het
Scn4a T C 11: 106,339,386 E532G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc23a1 A G 18: 35,622,510 probably null Het
Sowaha C T 11: 53,479,528 R127Q probably benign Het
Spag9 T C 11: 94,100,135 W626R probably damaging Het
Vmn1r193 A T 13: 22,219,555 F89Y probably damaging Het
Zfp507 T C 7: 35,775,996 N931D probably damaging Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
IGL02837:Trim45 UTSW 3 100931627 intron probably benign
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1222:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R2383:Trim45 UTSW 3 100925227 missense probably damaging 0.97
R4368:Trim45 UTSW 3 100923186 missense probably damaging 1.00
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R6850:Trim45 UTSW 3 100923225 nonsense probably null
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGTGAACAACGCCCTCCAAG -3'
(R):5'- CTTCCTGCGTGTTAATGGCC -3'

Sequencing Primer
(F):5'- GGACATTCTCTGAGGGCTACATC -3'
(R):5'- GCGTGTTAATGGCCCCATACAC -3'
Posted On2016-07-22