Incidental Mutation 'R5298:Cdcp2'
ID405524
Institutional Source Beutler Lab
Gene Symbol Cdcp2
Ensembl Gene ENSMUSG00000047636
Gene NameCUB domain containing protein 2
Synonyms
MMRRC Submission 042881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5298 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location107096891-107113125 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107106985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 344 (V344A)
Ref Sequence ENSEMBL: ENSMUSP00000061401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062495] [ENSMUST00000221740]
Predicted Effect probably benign
Transcript: ENSMUST00000062495
AA Change: V344A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000061401
Gene: ENSMUSG00000047636
AA Change: V344A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CUB 30 143 1.74e-42 SMART
CUB 145 255 2.37e-35 SMART
CUB 257 373 9.57e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221740
AA Change: V344A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,098,887 V287A possibly damaging Het
Adat2 A G 10: 13,556,906 N51D probably benign Het
Alms1-ps1 T C 6: 85,752,118 noncoding transcript Het
Ccdc97 A G 7: 25,716,007 V12A probably damaging Het
Clasp1 A G 1: 118,547,920 D929G possibly damaging Het
Clip4 A G 17: 71,834,225 N525D probably damaging Het
Csde1 T A 3: 103,047,209 probably null Het
D330020A13Rik T C 6: 120,294,816 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam208b T C 13: 3,595,613 probably null Het
Fuca1 C A 4: 135,936,926 Y374* probably null Het
Gle1 C G 2: 29,948,943 P457A probably benign Het
Hadhb T C 5: 30,177,011 probably null Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lef1 A T 3: 131,194,667 R294S possibly damaging Het
Lrriq4 G T 3: 30,645,332 M1I probably null Het
Magi2 T C 5: 20,569,162 S884P probably damaging Het
Mon2 A G 10: 123,010,606 I1353T probably benign Het
Olfr1262 T A 2: 90,002,460 L18Q possibly damaging Het
Olfr510 A G 7: 108,668,072 I219V probably benign Het
Parg C A 14: 32,202,253 A3E probably damaging Het
Per3 A T 4: 151,029,209 D297E probably damaging Het
Pkhd1l1 A T 15: 44,504,046 Y780F probably benign Het
Plcg2 A G 8: 117,605,249 Y858C probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Qsox2 A C 2: 26,214,062 S484A probably damaging Het
Reep4 G A 14: 70,548,197 G225D possibly damaging Het
Scn4a T C 11: 106,339,386 E532G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc23a1 A G 18: 35,622,510 probably null Het
Sowaha C T 11: 53,479,528 R127Q probably benign Het
Spag9 T C 11: 94,100,135 W626R probably damaging Het
Trim45 A G 3: 100,925,471 D340G probably damaging Het
Vmn1r193 A T 13: 22,219,555 F89Y probably damaging Het
Zfp507 T C 7: 35,775,996 N931D probably damaging Het
Other mutations in Cdcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdcp2 APN 4 107107111 missense probably benign
IGL02041:Cdcp2 APN 4 107107189 intron probably benign
IGL03396:Cdcp2 APN 4 107107172 nonsense probably null
R0128:Cdcp2 UTSW 4 107106707 splice site probably benign
R0130:Cdcp2 UTSW 4 107106707 splice site probably benign
R0519:Cdcp2 UTSW 4 107107192 intron probably benign
R0543:Cdcp2 UTSW 4 107097676 unclassified probably null
R1376:Cdcp2 UTSW 4 107102759 missense possibly damaging 0.93
R1376:Cdcp2 UTSW 4 107102759 missense possibly damaging 0.93
R1606:Cdcp2 UTSW 4 107102513 missense probably damaging 1.00
R1866:Cdcp2 UTSW 4 107107000 missense probably damaging 0.99
R1887:Cdcp2 UTSW 4 107102702 missense probably damaging 1.00
R2944:Cdcp2 UTSW 4 107102558 missense possibly damaging 0.88
R4620:Cdcp2 UTSW 4 107106730 missense probably damaging 0.99
R4816:Cdcp2 UTSW 4 107106772 missense probably damaging 1.00
R5646:Cdcp2 UTSW 4 107105142 missense probably damaging 1.00
R5979:Cdcp2 UTSW 4 107105281 missense probably damaging 1.00
R6062:Cdcp2 UTSW 4 107102492 missense probably damaging 1.00
R6702:Cdcp2 UTSW 4 107107086 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATATCCGTTGCCACTGGACC -3'
(R):5'- ATAAATGAGGGCCGTACTGG -3'

Sequencing Primer
(F):5'- TTGCCACTGGACCATCCG -3'
(R):5'- TCCAAGGTCCCCAGGGTAG -3'
Posted On2016-07-22