Incidental Mutation 'R5298:Olfr510'
ID405533
Institutional Source Beutler Lab
Gene Symbol Olfr510
Ensembl Gene ENSMUSG00000096209
Gene Nameolfactory receptor 510
SynonymsMOR204-34, GA_x6K02T2PBJ9-10997715-10998659
MMRRC Submission 042881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5298 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108666418-108670259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108668072 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 219 (I219V)
Ref Sequence ENSEMBL: ENSMUSP00000149693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076289] [ENSMUST00000213979] [ENSMUST00000216331] [ENSMUST00000217170]
Predicted Effect probably benign
Transcript: ENSMUST00000076289
AA Change: I219V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000075637
Gene: ENSMUSG00000096209
AA Change: I219V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210621
AA Change: I219V
Predicted Effect probably benign
Transcript: ENSMUST00000213979
AA Change: I219V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000216331
AA Change: I219V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000217170
AA Change: I219V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,098,887 V287A possibly damaging Het
Adat2 A G 10: 13,556,906 N51D probably benign Het
Alms1-ps1 T C 6: 85,752,118 noncoding transcript Het
Ccdc97 A G 7: 25,716,007 V12A probably damaging Het
Cdcp2 T C 4: 107,106,985 V344A probably benign Het
Clasp1 A G 1: 118,547,920 D929G possibly damaging Het
Clip4 A G 17: 71,834,225 N525D probably damaging Het
Csde1 T A 3: 103,047,209 probably null Het
D330020A13Rik T C 6: 120,294,816 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam208b T C 13: 3,595,613 probably null Het
Fuca1 C A 4: 135,936,926 Y374* probably null Het
Gle1 C G 2: 29,948,943 P457A probably benign Het
Hadhb T C 5: 30,177,011 probably null Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lef1 A T 3: 131,194,667 R294S possibly damaging Het
Lrriq4 G T 3: 30,645,332 M1I probably null Het
Magi2 T C 5: 20,569,162 S884P probably damaging Het
Mon2 A G 10: 123,010,606 I1353T probably benign Het
Olfr1262 T A 2: 90,002,460 L18Q possibly damaging Het
Parg C A 14: 32,202,253 A3E probably damaging Het
Per3 A T 4: 151,029,209 D297E probably damaging Het
Pkhd1l1 A T 15: 44,504,046 Y780F probably benign Het
Plcg2 A G 8: 117,605,249 Y858C probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Qsox2 A C 2: 26,214,062 S484A probably damaging Het
Reep4 G A 14: 70,548,197 G225D possibly damaging Het
Scn4a T C 11: 106,339,386 E532G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc23a1 A G 18: 35,622,510 probably null Het
Sowaha C T 11: 53,479,528 R127Q probably benign Het
Spag9 T C 11: 94,100,135 W626R probably damaging Het
Trim45 A G 3: 100,925,471 D340G probably damaging Het
Vmn1r193 A T 13: 22,219,555 F89Y probably damaging Het
Zfp507 T C 7: 35,775,996 N931D probably damaging Het
Other mutations in Olfr510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Olfr510 APN 7 108667700 missense possibly damaging 0.61
IGL00952:Olfr510 APN 7 108668238 missense possibly damaging 0.89
IGL01358:Olfr510 APN 7 108667662 missense possibly damaging 0.90
IGL01663:Olfr510 APN 7 108667891 missense probably benign 0.01
IGL02686:Olfr510 APN 7 108667886 missense probably benign 0.00
PIT4466001:Olfr510 UTSW 7 108667536 missense possibly damaging 0.52
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0792:Olfr510 UTSW 7 108668157 missense probably damaging 1.00
R0925:Olfr510 UTSW 7 108668193 missense probably benign 0.00
R1829:Olfr510 UTSW 7 108667644 missense probably benign 0.24
R2092:Olfr510 UTSW 7 108667662 frame shift probably null
R2483:Olfr510 UTSW 7 108667662 frame shift probably null
R3619:Olfr510 UTSW 7 108667850 missense probably benign 0.00
R4386:Olfr510 UTSW 7 108668253 missense probably damaging 0.99
R5622:Olfr510 UTSW 7 108668082 missense probably benign
R6079:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R6138:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R8359:Olfr510 UTSW 7 108668311 missense probably benign 0.00
U15987:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
Z1177:Olfr510 UTSW 7 108667836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAACAAGTGTGTATCCAATTGC -3'
(R):5'- GGGGTTCAACATGGGAATCAC -3'

Sequencing Primer
(F):5'- CAAGTGTGTATCCAATTGCTTGTAG -3'
(R):5'- GAACACAGATATCACCTTGTTCTGG -3'
Posted On2016-07-22