Incidental Mutation 'R5298:Adat2'
ID405538
Institutional Source Beutler Lab
Gene Symbol Adat2
Ensembl Gene ENSMUSG00000019808
Gene Nameadenosine deaminase, tRNA-specific 2
SynonymsDeadc1, 4933426M09Rik
MMRRC Submission 042881-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.938) question?
Stock #R5298 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location13552894-13563376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13556906 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 51 (N51D)
Ref Sequence ENSEMBL: ENSMUSP00000019944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019944] [ENSMUST00000019945] [ENSMUST00000105539] [ENSMUST00000105541] [ENSMUST00000170376]
Predicted Effect probably benign
Transcript: ENSMUST00000019944
AA Change: N51D

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000019944
Gene: ENSMUSG00000019808
AA Change: N51D

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 126 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019945
SMART Domains Protein: ENSMUSP00000019945
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 4 99 9.9e-23 PFAM
Pfam:Peroxin-3 94 363 5.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105539
SMART Domains Protein: ENSMUSP00000101178
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 298 6.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105541
SMART Domains Protein: ENSMUSP00000101180
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 28 286 2e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145337
Predicted Effect probably benign
Transcript: ENSMUST00000170376
SMART Domains Protein: ENSMUSP00000128512
Gene: ENSMUSG00000019809

DomainStartEndE-ValueType
Pfam:Peroxin-3 2 97 2.4e-35 PFAM
Pfam:Peroxin-3 94 352 7.3e-75 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,098,887 V287A possibly damaging Het
Alms1-ps1 T C 6: 85,752,118 noncoding transcript Het
Ccdc97 A G 7: 25,716,007 V12A probably damaging Het
Cdcp2 T C 4: 107,106,985 V344A probably benign Het
Clasp1 A G 1: 118,547,920 D929G possibly damaging Het
Clip4 A G 17: 71,834,225 N525D probably damaging Het
Csde1 T A 3: 103,047,209 probably null Het
D330020A13Rik T C 6: 120,294,816 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Fam208b T C 13: 3,595,613 probably null Het
Fuca1 C A 4: 135,936,926 Y374* probably null Het
Gle1 C G 2: 29,948,943 P457A probably benign Het
Hadhb T C 5: 30,177,011 probably null Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lef1 A T 3: 131,194,667 R294S possibly damaging Het
Lrriq4 G T 3: 30,645,332 M1I probably null Het
Magi2 T C 5: 20,569,162 S884P probably damaging Het
Mon2 A G 10: 123,010,606 I1353T probably benign Het
Olfr1262 T A 2: 90,002,460 L18Q possibly damaging Het
Olfr510 A G 7: 108,668,072 I219V probably benign Het
Parg C A 14: 32,202,253 A3E probably damaging Het
Per3 A T 4: 151,029,209 D297E probably damaging Het
Pkhd1l1 A T 15: 44,504,046 Y780F probably benign Het
Plcg2 A G 8: 117,605,249 Y858C probably benign Het
Prkca A T 11: 108,012,684 N287K probably damaging Het
Qsox2 A C 2: 26,214,062 S484A probably damaging Het
Reep4 G A 14: 70,548,197 G225D possibly damaging Het
Scn4a T C 11: 106,339,386 E532G probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc23a1 A G 18: 35,622,510 probably null Het
Sowaha C T 11: 53,479,528 R127Q probably benign Het
Spag9 T C 11: 94,100,135 W626R probably damaging Het
Trim45 A G 3: 100,925,471 D340G probably damaging Het
Vmn1r193 A T 13: 22,219,555 F89Y probably damaging Het
Zfp507 T C 7: 35,775,996 N931D probably damaging Het
Other mutations in Adat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Adat2 APN 10 13560238 missense probably null 1.00
IGL03031:Adat2 APN 10 13556846 unclassified probably benign
R0243:Adat2 UTSW 10 13553293 missense probably benign
R2082:Adat2 UTSW 10 13560163 missense probably damaging 1.00
R4976:Adat2 UTSW 10 13556906 missense probably damaging 1.00
R5119:Adat2 UTSW 10 13556906 missense probably damaging 1.00
R7615:Adat2 UTSW 10 13553276 missense probably benign 0.02
R7845:Adat2 UTSW 10 13552997 utr 5 prime probably benign
X0061:Adat2 UTSW 10 13561710 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCATGTCTCTCTGCCTAG -3'
(R):5'- TGAGTCACTGTTACAATCATGAAAAGA -3'

Sequencing Primer
(F):5'- TAGTTCATTATCCACACCCCAG -3'
(R):5'- AAAGATCCTAGGGTTCCCTGG -3'
Posted On2016-07-22