Mutagenetix > Incidental Mutation

Incidental Mutation 'R0497:Arhgap23'

40554

Institutional Source

Beutler Lab

Gene Symbol

Arhgap23

Ensembl Gene

ENSMUSG00000049807

Gene Name

Rho GTPase activating protein 23

Synonyms

MMRRC Submission

038693-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0497 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97415533-97502402 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 97452163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 424 (S424G)

Ref Sequence

ENSEMBL: ENSMUSP00000112999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000107601
AA Change: S213G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807
AA Change: S213G

Domain	Start	End	E-Value	Type
low complexity region	246	258	N/A	INTRINSIC
low complexity region	354	369	N/A	INTRINSIC
low complexity region	426	443	N/A	INTRINSIC
PH	479	600	3.2e-12	SMART
low complexity region	679	687	N/A	INTRINSIC
RhoGAP	707	884	6.83e-65	SMART
low complexity region	1051	1066	N/A	INTRINSIC
low complexity region	1101	1114	N/A	INTRINSIC
low complexity region	1125	1146	N/A	INTRINSIC
low complexity region	1176	1194	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121799
AA Change: S424G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807
AA Change: S424G

Domain	Start	End	E-Value	Type
low complexity region	8	29	N/A	INTRINSIC
PDZ	52	160	4.2e-17	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	565	580	N/A	INTRINSIC
low complexity region	637	654	N/A	INTRINSIC
PH	690	811	3.2e-12	SMART
low complexity region	890	898	N/A	INTRINSIC
RhoGAP	918	1095	6.83e-65	SMART
low complexity region	1262	1277	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
low complexity region	1336	1357	N/A	INTRINSIC
low complexity region	1387	1405	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142465

SMART Domains

Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

Domain	Start	End	E-Value	Type
low complexity region	54	69	N/A	INTRINSIC
low complexity region	126	143	N/A	INTRINSIC
PH	179	300	3.2e-12	SMART
low complexity region	379	387	N/A	INTRINSIC
RhoGAP	407	584	6.83e-65	SMART

Meta Mutation Damage Score

0.0867

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,147,465	C1158S	probably damaging	Het
Aatk	A	C	11: 120,018,780	V110G	probably damaging	Het
Adcy6	A	C	15: 98,597,725		probably null	Het
Adm	A	G	7: 110,629,121	T170A	probably benign	Het
Afap1l2	G	T	19: 56,930,209	N171K	probably benign	Het
Aph1b	G	T	9: 66,790,618	S112*	probably null	Het
Asah2	T	A	19: 32,054,631	N46I	probably benign	Het
Braf	G	A	6: 39,640,549		probably benign	Het
Brd2	C	T	17: 34,114,360	R47Q	probably damaging	Het
C2cd5	A	G	6: 143,012,093	V972A	probably benign	Het
Car9	T	A	4: 43,511,881	L300H	probably damaging	Het
Chmp3	T	C	6: 71,552,411	S20P	probably damaging	Het
Chp1	A	G	2: 119,571,782	N79S	possibly damaging	Het
Cnot2	A	T	10: 116,498,355	I335N	probably damaging	Het
Cntnap4	T	C	8: 112,570,151	V6A	probably benign	Het
Ctcf	T	A	8: 105,675,040		probably benign	Het
Dennd1b	A	G	1: 139,039,986		probably benign	Het
Dirc2	A	T	16: 35,735,604	V162D	probably benign	Het
Dnmbp	A	G	19: 43,856,640		probably benign	Het
Eef2	T	C	10: 81,181,586	F782L	probably benign	Het
Eogt	T	A	6: 97,135,233	Y153F	probably benign	Het
Fam81a	G	T	9: 70,096,119	Q237K	possibly damaging	Het
Fat2	T	A	11: 55,283,402	T2162S	probably benign	Het
Gas6	T	C	8: 13,470,387	I434V	possibly damaging	Het
Gm42417	A	T	1: 36,532,167	L77Q	probably damaging	Het
Grik3	A	T	4: 125,623,510	N49Y	possibly damaging	Het
Gucy2e	A	T	11: 69,224,159	V974E	probably damaging	Het
Helz2	A	G	2: 181,229,656	V2721A	probably damaging	Het
Klhl6	GT	G	16: 19,956,966	279	probably null	Het
Krt73	A	G	15: 101,802,230	L23P	probably damaging	Het
L3mbtl3	T	C	10: 26,282,874		probably benign	Het
Lrrc15	A	T	16: 30,272,892	V543E	probably damaging	Het
Med13	G	A	11: 86,276,983		probably benign	Het
Med25	T	C	7: 44,892,100	D60G	probably damaging	Het
Mgam	T	A	6: 40,664,892	Y560N	probably damaging	Het
Mlkl	A	G	8: 111,327,873	Y211H	probably damaging	Het
Msl2	A	G	9: 101,101,294	N289S	probably benign	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1281	A	G	2: 111,328,830	D137G	probably benign	Het
Omt2b	T	C	9: 78,328,231		probably benign	Het
Pald1	A	G	10: 61,341,315	L652P	probably damaging	Het
Pard3b	T	A	1: 62,440,008		probably null	Het
Prdm15	G	A	16: 97,794,334	T1098I	possibly damaging	Het
Rock2	A	G	12: 16,954,953	T436A	probably benign	Het
Sema4c	A	T	1: 36,549,608	D812E	probably benign	Het
Sla	A	T	15: 66,792,249	I91K	probably benign	Het
Slc22a16	T	G	10: 40,584,967	M255R	probably damaging	Het
Smg8	C	T	11: 87,086,084	D224N	possibly damaging	Het
Spdef	A	T	17: 27,718,058	D190E	probably benign	Het
Taok1	A	G	11: 77,573,804	I152T	probably damaging	Het
Tmem220	A	G	11: 67,025,922	D36G	probably damaging	Het
Tmem235	A	C	11: 117,864,351	I210L	probably benign	Het
Tmem266	C	T	9: 55,380,884		probably null	Het
Tmprss12	A	G	15: 100,281,039		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Usp38	T	A	8: 80,984,424		probably benign	Het
Usp44	C	T	10: 93,846,806	P373S	possibly damaging	Het
Vmn1r209	G	T	13: 22,805,948	Q191K	probably damaging	Het
Vmn1r70	T	C	7: 10,634,026	I147T	probably benign	Het
Vmn2r107	T	A	17: 20,375,132	I649N	probably damaging	Het
Vmn2r12	A	T	5: 109,091,889	Y269*	probably null	Het
Zan	C	T	5: 137,412,676		probably benign	Het
Zfp616	G	T	11: 74,083,480	V192L	probably benign	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zgrf1	T	C	3: 127,584,650		probably benign	Het
Zhx3	A	T	2: 160,779,994	L751*	probably null	Het
Znfx1	T	A	2: 167,055,411	Q531L	probably benign	Het

Other mutations in Arhgap23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Arhgap23	APN	11	97492671	intron	probably benign
IGL00493:Arhgap23	APN	11	97446553	critical splice donor site	probably null
IGL01729:Arhgap23	APN	11	97453961	missense	probably damaging	1.00
IGL01805:Arhgap23	APN	11	97492602	intron	probably benign
IGL02005:Arhgap23	APN	11	97491219	missense	probably damaging	0.99
IGL02026:Arhgap23	APN	11	97451581	missense	probably damaging	0.99
IGL02135:Arhgap23	APN	11	97451702	missense	probably damaging	0.97
IGL02178:Arhgap23	APN	11	97452353	missense	probably benign	0.42
IGL02226:Arhgap23	APN	11	97451600	missense	probably benign	0.07
IGL02309:Arhgap23	APN	11	97466001	splice site	probably benign
IGL02399:Arhgap23	APN	11	97491005	intron	probably benign
IGL02630:Arhgap23	APN	11	97454297	missense	probably benign	0.24
IGL02724:Arhgap23	APN	11	97491179	missense	probably damaging	0.99
IGL02740:Arhgap23	APN	11	97475017	missense	probably damaging	1.00
IGL02746:Arhgap23	APN	11	97454204	splice site	probably benign
IGL02862:Arhgap23	APN	11	97456480	missense	probably damaging	1.00
IGL03380:Arhgap23	APN	11	97452518	missense	probably damaging	1.00
R0091:Arhgap23	UTSW	11	97452244	missense	probably benign	0.44
R0134:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0225:Arhgap23	UTSW	11	97444328	missense	probably benign	0.09
R0305:Arhgap23	UTSW	11	97501109	missense	probably damaging	0.99
R0358:Arhgap23	UTSW	11	97463588	missense	probably damaging	1.00
R0422:Arhgap23	UTSW	11	97463652	missense	probably damaging	1.00
R0580:Arhgap23	UTSW	11	97446536	frame shift	probably null
R0782:Arhgap23	UTSW	11	97500554	missense	possibly damaging	0.73
R1216:Arhgap23	UTSW	11	97492672	intron	probably benign
R1488:Arhgap23	UTSW	11	97500859	missense	possibly damaging	0.53
R1785:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R1844:Arhgap23	UTSW	11	97463408	missense	probably damaging	1.00
R1855:Arhgap23	UTSW	11	97448697	missense	probably damaging	0.99
R1977:Arhgap23	UTSW	11	97451447	missense	possibly damaging	0.95
R2064:Arhgap23	UTSW	11	97493062	missense	probably benign	0.02
R2130:Arhgap23	UTSW	11	97451561	missense	possibly damaging	0.77
R2431:Arhgap23	UTSW	11	97452404	missense	probably benign
R2853:Arhgap23	UTSW	11	97492594	splice site	probably null
R3767:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3768:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3769:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R3770:Arhgap23	UTSW	11	97476106	missense	probably damaging	1.00
R4209:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R4247:Arhgap23	UTSW	11	97463699	missense	probably damaging	1.00
R4997:Arhgap23	UTSW	11	97452020	missense	probably damaging	0.98
R5399:Arhgap23	UTSW	11	97500917	missense	probably damaging	0.97
R5549:Arhgap23	UTSW	11	97466568	missense	probably damaging	0.96
R5655:Arhgap23	UTSW	11	97452546	critical splice donor site	probably null
R5857:Arhgap23	UTSW	11	97451579	missense	possibly damaging	0.93
R6013:Arhgap23	UTSW	11	97500992	missense	probably damaging	0.99
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6031:Arhgap23	UTSW	11	97476139	missense	probably damaging	1.00
R6077:Arhgap23	UTSW	11	97491232	critical splice donor site	probably null
R6151:Arhgap23	UTSW	11	97500412	missense	probably benign	0.01
R6393:Arhgap23	UTSW	11	97463672	missense	probably damaging	0.98
R6693:Arhgap23	UTSW	11	97466517	missense	probably damaging	1.00
R6752:Arhgap23	UTSW	11	97452248	missense	probably damaging	0.98
R7202:Arhgap23	UTSW	11	97451993	missense	possibly damaging	0.65
R7209:Arhgap23	UTSW	11	97476085	missense	probably damaging	1.00
R7209:Arhgap23	UTSW	11	97492447	splice site	probably null
R7320:Arhgap23	UTSW	11	97451545	missense	probably benign	0.10
R7345:Arhgap23	UTSW	11	97466478	missense	possibly damaging	0.91
R7599:Arhgap23	UTSW	11	97500343	missense	probably benign
R8229:Arhgap23	UTSW	11	97453906	missense	probably benign	0.36
R8412:Arhgap23	UTSW	11	97466028	missense	probably benign	0.02
R8460:Arhgap23	UTSW	11	97452371	missense	probably damaging	1.00
R8492:Arhgap23	UTSW	11	97475021	missense	probably damaging	1.00
R8525:Arhgap23	UTSW	11	97490084	missense	probably damaging	1.00
R8692:Arhgap23	UTSW	11	97454496	missense	probably damaging	0.99
R8708:Arhgap23	UTSW	11	97452412	missense	probably benign	0.06
R8749:Arhgap23	UTSW	11	97500815	missense	probably damaging	0.99
R8882:Arhgap23	UTSW	11	97465123	missense	probably benign	0.00
R9188:Arhgap23	UTSW	11	97500157	missense	possibly damaging	0.72
RF020:Arhgap23	UTSW	11	97463561	missense	probably damaging	1.00
V8831:Arhgap23	UTSW	11	97456545	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTCCAATCAGATACCCCGCAGAG -3'
(R):5'- TCACCAAATCCAAGGTTCATCTGCC -3'

Sequencing Primer
(F):5'- TTGGAGGATGTGACTACCCAC -3'
(R):5'- ATCACGATGATCCTCTGCG -3'

Posted On

2013-05-23