Incidental Mutation 'R5299:Vmn1r38'
ID405563
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
MMRRC Submission 042882-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R5299 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66776698 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 145 (T145S)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect probably benign
Transcript: ENSMUST00000176121
AA Change: T145S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: T145S

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226457
AA Change: T145S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000227493
AA Change: T145S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000227694
AA Change: T145S

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,431,861 I3838V probably damaging Het
Arid1a A T 4: 133,687,226 D1231E unknown Het
Atxn1 A T 13: 45,557,254 I734K probably benign Het
Axin1 A G 17: 26,173,734 S330G probably damaging Het
Bend3 G A 10: 43,493,690 probably null Het
Chodl C T 16: 78,941,408 T88I probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dst A G 1: 34,135,092 I179M probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Exoc2 A T 13: 30,871,918 probably null Het
Grk2 T C 19: 4,292,771 E45G probably damaging Het
Ift81 T C 5: 122,607,056 Y144C probably damaging Het
Ighv1-15 T C 12: 114,657,378 D109G probably damaging Het
Igtp T C 11: 58,207,133 W377R possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map2k6 A G 11: 110,492,963 D145G probably benign Het
Mcph1 T C 8: 18,652,580 probably benign Het
Mdfi A G 17: 47,820,834 V95A possibly damaging Het
Mical3 A G 6: 120,959,512 L1351P possibly damaging Het
Nbas C T 12: 13,441,925 Q1506* probably null Het
Nelfb A G 2: 25,210,745 V128A probably benign Het
Otog A G 7: 46,288,851 T1995A probably benign Het
Ppp1r7 A T 1: 93,352,626 I139L probably benign Het
Ppp2r1b A G 9: 50,857,040 D19G probably benign Het
Proca1 T C 11: 78,205,252 S150P probably damaging Het
Rhof A G 5: 123,120,548 V100A probably damaging Het
Rsbn1 G C 3: 103,914,490 G14R probably benign Het
Serinc1 A G 10: 57,523,051 I252T probably damaging Het
Skint4 A T 4: 112,136,006 I309F possibly damaging Het
Slc12a3 A G 8: 94,351,789 Y815C probably damaging Het
Slc25a24 A G 3: 109,166,352 S424G probably benign Het
Spint2 G A 7: 29,263,726 A49V probably damaging Het
Traf3ip3 T A 1: 193,178,175 K480* probably null Het
Ube2g2 T C 10: 77,644,545 S162P possibly damaging Het
Ubxn8 C A 8: 33,641,919 V7L possibly damaging Het
Vmn1r200 T A 13: 22,395,775 C249* probably null Het
Wapl G A 14: 34,733,808 probably null Het
Wfdc6a T C 2: 164,580,391 N96S possibly damaging Het
Zfp503 A G 14: 21,985,439 S470P probably benign Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R0890:Vmn1r38 UTSW 6 66776530 missense probably benign 0.01
R1242:Vmn1r38 UTSW 6 66776360 nonsense probably null
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2320:Vmn1r38 UTSW 6 66776550 missense possibly damaging 0.94
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3104:Vmn1r38 UTSW 6 66776446 missense probably benign 0.31
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R4532:Vmn1r38 UTSW 6 66777032 missense probably benign 0.38
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
R8044:Vmn1r38 UTSW 6 66776532 missense not run
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCGCTATGAAGATGCTTG -3'
(R):5'- ACAGGGCAATGAGAGGTCTC -3'

Sequencing Primer
(F):5'- GCATTGCCTCTGATGTCTGAACAAG -3'
(R):5'- GAGGTCTCTCTATCAGCATCAC -3'
Posted On2016-07-22