Incidental Mutation 'R5299:Mical3'
ID405564
Institutional Source Beutler Lab
Gene Symbol Mical3
Ensembl Gene ENSMUSG00000051586
Gene Namemicrotubule associated monooxygenase, calponin and LIM domain containing 3
SynonymsMICAL-3, C130040D16Rik
MMRRC Submission 042882-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5299 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location120931707-121130999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120959512 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1351 (L1351P)
Ref Sequence ENSEMBL: ENSMUSP00000146544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000207889]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098457
SMART Domains Protein: ENSMUSP00000096056
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 57 80 N/A INTRINSIC
coiled coil region 114 148 N/A INTRINSIC
low complexity region 191 225 N/A INTRINSIC
coiled coil region 238 265 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 582 592 N/A INTRINSIC
low complexity region 625 637 N/A INTRINSIC
low complexity region 794 824 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
low complexity region 911 929 N/A INTRINSIC
low complexity region 950 962 N/A INTRINSIC
DUF3585 968 1110 1.39e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150503
SMART Domains Protein: ENSMUSP00000115131
Gene: ENSMUSG00000051586

DomainStartEndE-ValueType
SCOP:d1bjt__ 41 141 8e-3 SMART
coiled coil region 192 219 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 328 337 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 536 546 N/A INTRINSIC
low complexity region 579 591 N/A INTRINSIC
low complexity region 748 778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203013
Predicted Effect possibly damaging
Transcript: ENSMUST00000207889
AA Change: L1351P

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000212333
AA Change: L479P
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,431,861 I3838V probably damaging Het
Arid1a A T 4: 133,687,226 D1231E unknown Het
Atxn1 A T 13: 45,557,254 I734K probably benign Het
Axin1 A G 17: 26,173,734 S330G probably damaging Het
Bend3 G A 10: 43,493,690 probably null Het
Chodl C T 16: 78,941,408 T88I probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dst A G 1: 34,135,092 I179M probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Exoc2 A T 13: 30,871,918 probably null Het
Grk2 T C 19: 4,292,771 E45G probably damaging Het
Ift81 T C 5: 122,607,056 Y144C probably damaging Het
Ighv1-15 T C 12: 114,657,378 D109G probably damaging Het
Igtp T C 11: 58,207,133 W377R possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map2k6 A G 11: 110,492,963 D145G probably benign Het
Mcph1 T C 8: 18,652,580 probably benign Het
Mdfi A G 17: 47,820,834 V95A possibly damaging Het
Nbas C T 12: 13,441,925 Q1506* probably null Het
Nelfb A G 2: 25,210,745 V128A probably benign Het
Otog A G 7: 46,288,851 T1995A probably benign Het
Ppp1r7 A T 1: 93,352,626 I139L probably benign Het
Ppp2r1b A G 9: 50,857,040 D19G probably benign Het
Proca1 T C 11: 78,205,252 S150P probably damaging Het
Rhof A G 5: 123,120,548 V100A probably damaging Het
Rsbn1 G C 3: 103,914,490 G14R probably benign Het
Serinc1 A G 10: 57,523,051 I252T probably damaging Het
Skint4 A T 4: 112,136,006 I309F possibly damaging Het
Slc12a3 A G 8: 94,351,789 Y815C probably damaging Het
Slc25a24 A G 3: 109,166,352 S424G probably benign Het
Spint2 G A 7: 29,263,726 A49V probably damaging Het
Traf3ip3 T A 1: 193,178,175 K480* probably null Het
Ube2g2 T C 10: 77,644,545 S162P possibly damaging Het
Ubxn8 C A 8: 33,641,919 V7L possibly damaging Het
Vmn1r200 T A 13: 22,395,775 C249* probably null Het
Vmn1r38 T A 6: 66,776,698 T145S probably benign Het
Wapl G A 14: 34,733,808 probably null Het
Wfdc6a T C 2: 164,580,391 N96S possibly damaging Het
Zfp503 A G 14: 21,985,439 S470P probably benign Het
Other mutations in Mical3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Mical3 APN 6 120961624 missense possibly damaging 0.73
IGL00718:Mical3 APN 6 121040449 missense probably damaging 0.98
IGL00940:Mical3 APN 6 121022410 missense possibly damaging 0.55
IGL00973:Mical3 APN 6 120934924 splice site probably benign
IGL01503:Mical3 APN 6 120958576 missense probably benign 0.09
IGL01991:Mical3 APN 6 120935211 missense probably damaging 0.98
IGL02794:Mical3 APN 6 121007309 missense probably damaging 0.99
IGL02996:Mical3 APN 6 120958558 missense probably damaging 1.00
IGL03105:Mical3 APN 6 121042238 missense probably benign 0.01
IGL03109:Mical3 APN 6 121009124 missense probably damaging 1.00
IGL03236:Mical3 APN 6 120969384 missense probably benign 0.00
P0028:Mical3 UTSW 6 121024689 missense probably benign 0.33
R0244:Mical3 UTSW 6 120957722 missense probably benign 0.00
R0494:Mical3 UTSW 6 120959201 missense possibly damaging 0.94
R0586:Mical3 UTSW 6 121029641 unclassified probably benign
R1029:Mical3 UTSW 6 120934678 missense probably benign 0.02
R1263:Mical3 UTSW 6 120952469 missense probably damaging 0.99
R1507:Mical3 UTSW 6 121042238 missense probably benign 0.36
R1527:Mical3 UTSW 6 121024779 missense probably damaging 0.99
R1623:Mical3 UTSW 6 121024807 missense probably damaging 0.99
R1680:Mical3 UTSW 6 120959643 missense probably benign 0.09
R1697:Mical3 UTSW 6 121007408 missense possibly damaging 0.84
R1817:Mical3 UTSW 6 121042235 missense probably benign 0.06
R1875:Mical3 UTSW 6 121042064 missense probably damaging 1.00
R1961:Mical3 UTSW 6 120982607 missense possibly damaging 0.94
R2004:Mical3 UTSW 6 120951322 missense probably damaging 1.00
R2093:Mical3 UTSW 6 121040386 missense probably damaging 1.00
R2141:Mical3 UTSW 6 121031134 splice site probably null
R2142:Mical3 UTSW 6 121031134 splice site probably null
R2257:Mical3 UTSW 6 121033735 missense possibly damaging 0.94
R2404:Mical3 UTSW 6 120959828 missense probably benign 0.01
R2419:Mical3 UTSW 6 120959923 missense probably benign
R2509:Mical3 UTSW 6 121034157 missense probably damaging 1.00
R3784:Mical3 UTSW 6 121021337 missense probably benign 0.00
R4342:Mical3 UTSW 6 120934838 nonsense probably null
R4343:Mical3 UTSW 6 120934838 nonsense probably null
R4579:Mical3 UTSW 6 120958699 missense probably benign
R4603:Mical3 UTSW 6 120934838 nonsense probably null
R4605:Mical3 UTSW 6 121034080 nonsense probably null
R4610:Mical3 UTSW 6 120934838 nonsense probably null
R4611:Mical3 UTSW 6 120934838 nonsense probably null
R4623:Mical3 UTSW 6 120961625 nonsense probably null
R4669:Mical3 UTSW 6 120957703 missense probably damaging 0.98
R4704:Mical3 UTSW 6 120958688 missense probably benign 0.00
R4722:Mical3 UTSW 6 121038525 missense probably benign 0.00
R4863:Mical3 UTSW 6 121033787 missense probably damaging 0.99
R4878:Mical3 UTSW 6 120969387 missense possibly damaging 0.51
R4885:Mical3 UTSW 6 120935253 missense probably damaging 1.00
R4907:Mical3 UTSW 6 121007298 missense probably benign 0.00
R5007:Mical3 UTSW 6 121038069 missense probably damaging 0.98
R5303:Mical3 UTSW 6 120959980 missense probably benign
R5368:Mical3 UTSW 6 120959473 missense probably damaging 1.00
R5955:Mical3 UTSW 6 121033750 missense probably damaging 0.99
R5970:Mical3 UTSW 6 120958271 nonsense probably null
R6000:Mical3 UTSW 6 121021320 missense probably benign 0.06
R6101:Mical3 UTSW 6 121033710 missense probably damaging 1.00
R6195:Mical3 UTSW 6 121016835 intron probably benign
R6210:Mical3 UTSW 6 121040517 unclassified probably null
R6225:Mical3 UTSW 6 120958723 missense probably damaging 0.98
R6258:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6260:Mical3 UTSW 6 121009030 missense probably damaging 1.00
R6349:Mical3 UTSW 6 120959525 missense probably benign
R6352:Mical3 UTSW 6 120952473 missense probably damaging 0.97
R6480:Mical3 UTSW 6 121034275 missense possibly damaging 0.76
R6704:Mical3 UTSW 6 121009800 intron probably benign
R6783:Mical3 UTSW 6 120958825 missense possibly damaging 0.85
R6925:Mical3 UTSW 6 120959390 missense probably benign 0.05
R6960:Mical3 UTSW 6 120958543 missense probably damaging 1.00
R7170:Mical3 UTSW 6 120973733 intron probably null
R7344:Mical3 UTSW 6 121036544 nonsense probably null
R7414:Mical3 UTSW 6 121034113 missense probably damaging 1.00
R7455:Mical3 UTSW 6 120958744 missense probably damaging 1.00
R7649:Mical3 UTSW 6 120934948 missense probably damaging 1.00
U24488:Mical3 UTSW 6 121001496 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CATGTTGGAGGAGCTATCATGG -3'
(R):5'- ATACGCTTCCAGCCAGTTCC -3'

Sequencing Primer
(F):5'- AGGAGCTATCATGGAGGCCC -3'
(R):5'- GCCAGTTCCAGCCAAAACATC -3'
Posted On2016-07-22