Incidental Mutation 'R5299:Spint2'
ID405565
Institutional Source Beutler Lab
Gene Symbol Spint2
Ensembl Gene ENSMUSG00000074227
Gene Nameserine protease inhibitor, Kunitz type 2
SynonymsHAI-2
MMRRC Submission 042882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5299 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29256323-29281912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29263726 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 49 (A49V)
Ref Sequence ENSEMBL: ENSMUSP00000096204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098604] [ENSMUST00000108236] [ENSMUST00000207601]
Predicted Effect probably damaging
Transcript: ENSMUST00000098604
AA Change: A49V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096204
Gene: ENSMUSG00000074227
AA Change: A49V

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
KU 36 89 3.02e-23 SMART
KU 131 184 2.34e-20 SMART
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108236
SMART Domains Protein: ENSMUSP00000103871
Gene: ENSMUSG00000074227

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
KU 74 127 2.34e-20 SMART
transmembrane domain 141 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous embryos carrying an insertional mutation fail to progress to the headfold stage and die at gastrulation displaying a severe clefting of the embryonic ectoderm at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,431,861 I3838V probably damaging Het
Arid1a A T 4: 133,687,226 D1231E unknown Het
Atxn1 A T 13: 45,557,254 I734K probably benign Het
Axin1 A G 17: 26,173,734 S330G probably damaging Het
Bend3 G A 10: 43,493,690 probably null Het
Chodl C T 16: 78,941,408 T88I probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dst A G 1: 34,135,092 I179M probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Exoc2 A T 13: 30,871,918 probably null Het
Grk2 T C 19: 4,292,771 E45G probably damaging Het
Ift81 T C 5: 122,607,056 Y144C probably damaging Het
Ighv1-15 T C 12: 114,657,378 D109G probably damaging Het
Igtp T C 11: 58,207,133 W377R possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map2k6 A G 11: 110,492,963 D145G probably benign Het
Mcph1 T C 8: 18,652,580 probably benign Het
Mdfi A G 17: 47,820,834 V95A possibly damaging Het
Mical3 A G 6: 120,959,512 L1351P possibly damaging Het
Nbas C T 12: 13,441,925 Q1506* probably null Het
Nelfb A G 2: 25,210,745 V128A probably benign Het
Otog A G 7: 46,288,851 T1995A probably benign Het
Ppp1r7 A T 1: 93,352,626 I139L probably benign Het
Ppp2r1b A G 9: 50,857,040 D19G probably benign Het
Proca1 T C 11: 78,205,252 S150P probably damaging Het
Rhof A G 5: 123,120,548 V100A probably damaging Het
Rsbn1 G C 3: 103,914,490 G14R probably benign Het
Serinc1 A G 10: 57,523,051 I252T probably damaging Het
Skint4 A T 4: 112,136,006 I309F possibly damaging Het
Slc12a3 A G 8: 94,351,789 Y815C probably damaging Het
Slc25a24 A G 3: 109,166,352 S424G probably benign Het
Traf3ip3 T A 1: 193,178,175 K480* probably null Het
Ube2g2 T C 10: 77,644,545 S162P possibly damaging Het
Ubxn8 C A 8: 33,641,919 V7L possibly damaging Het
Vmn1r200 T A 13: 22,395,775 C249* probably null Het
Vmn1r38 T A 6: 66,776,698 T145S probably benign Het
Wapl G A 14: 34,733,808 probably null Het
Wfdc6a T C 2: 164,580,391 N96S possibly damaging Het
Zfp503 A G 14: 21,985,439 S470P probably benign Het
Other mutations in Spint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03373:Spint2 APN 7 29258209 splice site probably benign
R1754:Spint2 UTSW 7 29260366 splice site probably null
R1992:Spint2 UTSW 7 29259408 missense probably damaging 1.00
R4172:Spint2 UTSW 7 29263672 missense probably damaging 0.99
R4668:Spint2 UTSW 7 29260379 missense probably damaging 0.96
R4852:Spint2 UTSW 7 29256786 missense probably benign 0.25
R6501:Spint2 UTSW 7 29263706 missense probably damaging 1.00
R6746:Spint2 UTSW 7 29259423 missense probably benign 0.01
R7604:Spint2 UTSW 7 29258519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGTTCTGACAGAAGTAGTAC -3'
(R):5'- GACAGCATCAGGACTCTCTG -3'

Sequencing Primer
(F):5'- GGTTCTGACAGAAGTAGTACACATCC -3'
(R):5'- AGCATCAGGACTCTCTGGGAAC -3'
Posted On2016-07-22