Incidental Mutation 'R5299:Wapl'
ID405586
Institutional Source Beutler Lab
Gene Symbol Wapl
Ensembl Gene ENSMUSG00000041408
Gene NameWAPL cohesin release factor
SynonymsA530089A20Rik, Wapal
MMRRC Submission 042882-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5299 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34673928-34747983 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 34733808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000090027] [ENSMUST00000169910]
Predicted Effect probably null
Transcript: ENSMUST00000048263
SMART Domains Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 645 1009 6.5e-153 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090027
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000090027
SMART Domains Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 639 1003 2.6e-153 PFAM
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111895
Predicted Effect probably null
Transcript: ENSMUST00000151285
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000151285
SMART Domains Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 281 1.1e-78 PFAM
coiled coil region 329 351 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169910
SMART Domains Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
low complexity region 436 455 N/A INTRINSIC
low complexity region 465 477 N/A INTRINSIC
low complexity region 493 513 N/A INTRINSIC
Pfam:WAPL 647 1008 3.5e-120 PFAM
low complexity region 1018 1033 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174559
SMART Domains Protein: ENSMUSP00000133779
Gene: ENSMUSG00000041408

DomainStartEndE-ValueType
Pfam:WAPL 1 55 8.6e-22 PFAM
low complexity region 64 79 N/A INTRINSIC
coiled coil region 119 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,431,861 I3838V probably damaging Het
Arid1a A T 4: 133,687,226 D1231E unknown Het
Atxn1 A T 13: 45,557,254 I734K probably benign Het
Axin1 A G 17: 26,173,734 S330G probably damaging Het
Bend3 G A 10: 43,493,690 probably null Het
Chodl C T 16: 78,941,408 T88I probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dst A G 1: 34,135,092 I179M probably damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Exoc2 A T 13: 30,871,918 probably null Het
Grk2 T C 19: 4,292,771 E45G probably damaging Het
Ift81 T C 5: 122,607,056 Y144C probably damaging Het
Ighv1-15 T C 12: 114,657,378 D109G probably damaging Het
Igtp T C 11: 58,207,133 W377R possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map2k6 A G 11: 110,492,963 D145G probably benign Het
Mcph1 T C 8: 18,652,580 probably benign Het
Mdfi A G 17: 47,820,834 V95A possibly damaging Het
Mical3 A G 6: 120,959,512 L1351P possibly damaging Het
Nbas C T 12: 13,441,925 Q1506* probably null Het
Nelfb A G 2: 25,210,745 V128A probably benign Het
Otog A G 7: 46,288,851 T1995A probably benign Het
Ppp1r7 A T 1: 93,352,626 I139L probably benign Het
Ppp2r1b A G 9: 50,857,040 D19G probably benign Het
Proca1 T C 11: 78,205,252 S150P probably damaging Het
Rhof A G 5: 123,120,548 V100A probably damaging Het
Rsbn1 G C 3: 103,914,490 G14R probably benign Het
Serinc1 A G 10: 57,523,051 I252T probably damaging Het
Skint4 A T 4: 112,136,006 I309F possibly damaging Het
Slc12a3 A G 8: 94,351,789 Y815C probably damaging Het
Slc25a24 A G 3: 109,166,352 S424G probably benign Het
Spint2 G A 7: 29,263,726 A49V probably damaging Het
Traf3ip3 T A 1: 193,178,175 K480* probably null Het
Ube2g2 T C 10: 77,644,545 S162P possibly damaging Het
Ubxn8 C A 8: 33,641,919 V7L possibly damaging Het
Vmn1r200 T A 13: 22,395,775 C249* probably null Het
Vmn1r38 T A 6: 66,776,698 T145S probably benign Het
Wfdc6a T C 2: 164,580,391 N96S possibly damaging Het
Zfp503 A G 14: 21,985,439 S470P probably benign Het
Other mutations in Wapl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Wapl APN 14 34692636 missense probably benign 0.00
IGL00539:Wapl APN 14 34695008 missense probably damaging 1.00
IGL00846:Wapl APN 14 34692744 splice site probably benign
IGL01070:Wapl APN 14 34745622 unclassified probably benign
IGL01516:Wapl APN 14 34692081 missense probably damaging 1.00
IGL02021:Wapl APN 14 34722336 missense probably benign
IGL02209:Wapl APN 14 34677261 missense possibly damaging 0.46
IGL02309:Wapl APN 14 34744863 missense probably damaging 0.98
IGL02471:Wapl APN 14 34691920 missense possibly damaging 0.68
IGL02965:Wapl APN 14 34739224 intron probably benign
IGL03076:Wapl APN 14 34692089 missense probably benign 0.26
IGL03197:Wapl APN 14 34745631 missense possibly damaging 0.77
Mcclintock UTSW 14 34730662 critical splice donor site probably null
R0045:Wapl UTSW 14 34733794 missense probably benign 0.18
R0278:Wapl UTSW 14 34692612 missense possibly damaging 0.68
R0335:Wapl UTSW 14 34692324 missense probably damaging 0.99
R1018:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R1295:Wapl UTSW 14 34724769 missense probably damaging 1.00
R1553:Wapl UTSW 14 34729190 missense probably damaging 1.00
R1868:Wapl UTSW 14 34692458 missense probably benign 0.00
R1909:Wapl UTSW 14 34691912 missense probably damaging 1.00
R2698:Wapl UTSW 14 34691777 missense probably benign
R2990:Wapl UTSW 14 34736708 missense probably damaging 0.98
R3121:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3122:Wapl UTSW 14 34729215 missense possibly damaging 0.93
R3147:Wapl UTSW 14 34725149 missense probably damaging 1.00
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3732:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3733:Wapl UTSW 14 34736764 missense probably damaging 0.99
R3878:Wapl UTSW 14 34692147 missense probably damaging 1.00
R4034:Wapl UTSW 14 34737914 missense possibly damaging 0.92
R4934:Wapl UTSW 14 34692095 missense probably benign 0.11
R5079:Wapl UTSW 14 34724757 missense probably damaging 1.00
R5104:Wapl UTSW 14 34692059 nonsense probably null
R5113:Wapl UTSW 14 34724754 missense probably damaging 1.00
R5121:Wapl UTSW 14 34677162 missense probably benign 0.01
R5222:Wapl UTSW 14 34736685 nonsense probably null
R5387:Wapl UTSW 14 34677295 missense probably benign 0.00
R5541:Wapl UTSW 14 34730662 critical splice donor site probably null
R5618:Wapl UTSW 14 34691906 missense possibly damaging 0.91
R5802:Wapl UTSW 14 34692320 missense probably damaging 1.00
R6029:Wapl UTSW 14 34739247 missense possibly damaging 0.94
R6292:Wapl UTSW 14 34729195 missense probably damaging 1.00
R6482:Wapl UTSW 14 34692692 missense probably benign 0.01
R6487:Wapl UTSW 14 34692292 missense probably damaging 1.00
R6925:Wapl UTSW 14 34677363 missense probably benign 0.31
R6937:Wapl UTSW 14 34722354 missense probably benign 0.01
R7080:Wapl UTSW 14 34692356 missense probably benign 0.03
R7203:Wapl UTSW 14 34736691 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTAGATGACAAGATCTGTTTCATC -3'
(R):5'- CAGAAATGGAGTTACAATCCACTTC -3'

Sequencing Primer
(F):5'- TCCATCCCTTCTAGGTAAC -3'
(R):5'- CAAGTCATTTGTCCTGGATTATAGC -3'
Posted On2016-07-22