Incidental Mutation 'R5300:Zfp667'
ID405599
Institutional Source Beutler Lab
Gene Symbol Zfp667
Ensembl Gene ENSMUSG00000054893
Gene Namezinc finger protein 667
SynonymsA830025F02Rik
MMRRC Submission 042883-MU
Accession Numbers

Genbank: NM_001024928

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location6286579-6307883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6304636 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 101 (H101R)
Ref Sequence ENSEMBL: ENSMUSP00000128658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086327] [ENSMUST00000108562] [ENSMUST00000153840] [ENSMUST00000170776]
Predicted Effect probably benign
Transcript: ENSMUST00000086327
AA Change: H101R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083507
Gene: ENSMUSG00000054893
AA Change: H101R

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108562
AA Change: H101R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104202
Gene: ENSMUSG00000054893
AA Change: H101R

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153840
Predicted Effect probably benign
Transcript: ENSMUST00000170776
AA Change: H101R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128658
Gene: ENSMUSG00000054893
AA Change: H101R

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Zfp667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp667 APN 7 6305397 missense possibly damaging 0.53
IGL01325:Zfp667 APN 7 6290546 missense probably damaging 1.00
IGL01386:Zfp667 APN 7 6304870 missense probably benign 0.00
IGL01960:Zfp667 APN 7 6305337 missense probably benign 0.00
IGL03394:Zfp667 APN 7 6289439 critical splice donor site probably null
B5639:Zfp667 UTSW 7 6290545 missense probably damaging 1.00
R0458:Zfp667 UTSW 7 6304845 missense probably benign 0.40
R0845:Zfp667 UTSW 7 6306092 missense possibly damaging 0.85
R1768:Zfp667 UTSW 7 6305067 missense possibly damaging 0.53
R1953:Zfp667 UTSW 7 6305088 missense probably benign 0.04
R2023:Zfp667 UTSW 7 6305417 missense possibly damaging 0.85
R3159:Zfp667 UTSW 7 6306000 missense probably damaging 1.00
R4080:Zfp667 UTSW 7 6305106 missense possibly damaging 0.71
R4476:Zfp667 UTSW 7 6304599 missense possibly damaging 0.53
R4584:Zfp667 UTSW 7 6290625 missense possibly damaging 0.84
R4783:Zfp667 UTSW 7 6305685 missense possibly damaging 0.83
R5037:Zfp667 UTSW 7 6305950 missense possibly damaging 0.71
R5311:Zfp667 UTSW 7 6305716 missense probably benign 0.10
R5312:Zfp667 UTSW 7 6305467 missense probably benign
R5340:Zfp667 UTSW 7 6305253 missense possibly damaging 0.53
R6262:Zfp667 UTSW 7 6304974 missense probably benign 0.03
R7386:Zfp667 UTSW 7 6305950 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTATGGTAAGACACATTGTTCTCG -3'
(R):5'- ACGTGTCTACAAGTACTGCATTC -3'

Sequencing Primer
(F):5'- GACACATTGTTCTCGTTAACATTGGG -3'
(R):5'- GACCTCTCTCCAGTGTGAAAG -3'
Posted On2016-07-22