Mutagenetix > Incidental Mutations

Incidental Mutation 'R5300:Dpy19l3'

405601

Institutional Source

Beutler Lab

Gene Symbol

Dpy19l3

Ensembl Gene

ENSMUSG00000043671

Gene Name

dpy-19-like 3 (C. elegans)

Synonyms

MMRRC Submission

042883-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R5300 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35685165-35754454 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 35727310 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 58 (Y58H)

Ref Sequence

ENSEMBL: ENSMUSP00000122489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000144416]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051377
AA Change: Y144H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: Y144H

Domain	Start	End	E-Value	Type
Pfam:Dpy19	55	712	2.2e-243	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127782

Predicted Effect

probably damaging
Transcript: ENSMUST00000144416
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122489
Gene: ENSMUSG00000043671
AA Change: Y58H

Domain	Start	End	E-Value	Type
Pfam:Dpy19	1	114	2.5e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155451

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155993

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205751

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AF529169	A	T	9: 89,603,199	S48R	probably damaging	Het
Ank1	A	G	8: 23,132,501	K1644E	probably benign	Het
C7	C	A	15: 5,031,950	G306W	probably damaging	Het
Ccdc185	A	G	1: 182,748,080	V348A	probably benign	Het
Cfap58	A	T	19: 47,941,156	I19F	probably benign	Het
Dnaaf2	C	G	12: 69,198,228	V20L	probably damaging	Het
Dsc1	T	C	18: 20,094,860	S480G	probably damaging	Het
Eno4	G	A	19: 58,955,550		probably null	Het
Gm136	T	G	4: 34,750,930	K114N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc37a	T	A	11: 103,456,958	L2970F	unknown	Het
Ly86	C	T	13: 37,418,612	T160I	probably benign	Het
Mfsd4b1	A	C	10: 40,003,031	F290C	probably benign	Het
Nbeal1	T	G	1: 60,235,559	Y376*	probably null	Het
Nipbl	A	T	15: 8,351,497	S604T	probably benign	Het
Pml	A	C	9: 58,247,019	N190K	probably damaging	Het
Rin3	C	A	12: 102,369,670	F533L	probably benign	Het
Scamp1	A	G	13: 94,204,162	V233A	probably damaging	Het
Sppl2c	A	T	11: 104,187,075	N234Y	possibly damaging	Het
Tfap2b	A	G	1: 19,228,453	K278R	probably damaging	Het
Tg	A	G	15: 66,678,855	Y278C	probably damaging	Het
Trdn	A	G	10: 33,195,982	E215G	probably damaging	Het
Tssk6	T	C	8: 69,902,635	S110P	probably benign	Het
Vmn2r15	A	T	5: 109,294,108	L153Q	probably damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Zfp667	A	G	7: 6,304,636	H101R	probably benign	Het
Zfp772	A	T	7: 7,204,158	M178K	probably benign	Het

Other mutations in Dpy19l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01066:Dpy19l3	APN	7	35692767	splice site	probably benign
IGL01351:Dpy19l3	APN	7	35727415	splice site	probably benign
IGL01622:Dpy19l3	APN	7	35722744	missense	probably damaging	1.00
IGL01623:Dpy19l3	APN	7	35722744	missense	probably damaging	1.00
IGL01645:Dpy19l3	APN	7	35695338	missense	probably benign	0.00
IGL02725:Dpy19l3	APN	7	35711918	missense	probably benign	0.01
IGL02817:Dpy19l3	APN	7	35692808	missense	probably damaging	1.00
IGL03130:Dpy19l3	APN	7	35752672	missense	probably benign	0.00
IGL03178:Dpy19l3	APN	7	35729729	nonsense	probably null
IGL03374:Dpy19l3	APN	7	35712208	missense	possibly damaging	0.82
R0143:Dpy19l3	UTSW	7	35714215	missense	probably benign	0.19
R0164:Dpy19l3	UTSW	7	35716646	missense	probably damaging	0.98
R0164:Dpy19l3	UTSW	7	35716646	missense	probably damaging	0.98
R0385:Dpy19l3	UTSW	7	35752705	missense	probably damaging	0.97
R0705:Dpy19l3	UTSW	7	35695316	missense	probably damaging	0.96
R1489:Dpy19l3	UTSW	7	35725410	nonsense	probably null
R1640:Dpy19l3	UTSW	7	35749778	missense	probably benign	0.41
R1782:Dpy19l3	UTSW	7	35708155	missense	possibly damaging	0.94
R1843:Dpy19l3	UTSW	7	35729760	missense	probably damaging	1.00
R2096:Dpy19l3	UTSW	7	35727288	critical splice donor site	probably null
R3814:Dpy19l3	UTSW	7	35727292	nonsense	probably null
R4438:Dpy19l3	UTSW	7	35692859	missense	probably damaging	1.00
R4537:Dpy19l3	UTSW	7	35711901	missense	probably benign	0.01
R4735:Dpy19l3	UTSW	7	35722721	missense	probably benign	0.00
R4737:Dpy19l3	UTSW	7	35703501	missense	probably damaging	1.00
R4864:Dpy19l3	UTSW	7	35712182	nonsense	probably null
R4915:Dpy19l3	UTSW	7	35752742	utr 5 prime	probably benign
R4920:Dpy19l3	UTSW	7	35708042	intron	probably benign
R5527:Dpy19l3	UTSW	7	35714130	missense	possibly damaging	0.95
R5801:Dpy19l3	UTSW	7	35725298	missense	probably benign	0.10
R6815:Dpy19l3	UTSW	7	35749847	missense	possibly damaging	0.67
R7150:Dpy19l3	UTSW	7	35708630	missense	probably benign
R7198:Dpy19l3	UTSW	7	35749765	missense	possibly damaging	0.73
R7378:Dpy19l3	UTSW	7	35752642	missense	probably benign	0.10
R7625:Dpy19l3	UTSW	7	35752681	missense	probably benign
R7641:Dpy19l3	UTSW	7	35695309	missense	probably damaging	1.00
R7674:Dpy19l3	UTSW	7	35695309	missense	probably damaging	1.00
R8034:Dpy19l3	UTSW	7	35749856	missense	probably benign
R8073:Dpy19l3	UTSW	7	35729748	missense	probably damaging	1.00
R8183:Dpy19l3	UTSW	7	35695389	missense	probably damaging	0.96
R8206:Dpy19l3	UTSW	7	35729730	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGCTCTAGACTGCATGC -3'
(R):5'- CACTCTGACTGGAATGCTAGAG -3'

Sequencing Primer
(F):5'- GCTCTAGACTGCATGCATAATTATG -3'
(R):5'- CTAGAGCAGTGTGTCGTGCC -3'

Posted On

2016-07-22