Incidental Mutation 'R5300:Tssk6'
ID405604
Institutional Source Beutler Lab
Gene Symbol Tssk6
Ensembl Gene ENSMUSG00000047654
Gene Nametestis-specific serine kinase 6
SynonymsSstk
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5300 (G1)
Quality Score175
Status Not validated
Chromosome8
Chromosomal Location69902184-69903518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69902635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 110 (S110P)
Ref Sequence ENSEMBL: ENSMUSP00000062783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050373] [ENSMUST00000110167] [ENSMUST00000177851] [ENSMUST00000180068]
Predicted Effect probably benign
Transcript: ENSMUST00000050373
AA Change: S110P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062783
Gene: ENSMUSG00000047654
AA Change: S110P

DomainStartEndE-ValueType
S_TKc 12 267 6.23e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110167
SMART Domains Protein: ENSMUSP00000105796
Gene: ENSMUSG00000036199

DomainStartEndE-ValueType
Pfam:GRIM-19 5 129 9.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177851
SMART Domains Protein: ENSMUSP00000137386
Gene: ENSMUSG00000036180

DomainStartEndE-ValueType
low complexity region 66 77 N/A INTRINSIC
coiled coil region 135 169 N/A INTRINSIC
low complexity region 275 288 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 339 351 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 464 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the CAMK (calcium/calmodulin-dependent) serine/threonine protein kinase family. The encoded kinase has a broad expression pattern but is described as testis-specific due to effects on fertility. Male mice which lack the gene encoding a highly similar protein are sterile and have morphologically abnormal sperm. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null males are infertile and exhibit decreased sperm numbers and sperm motility, abnormal sperm head morphology and reduced DNA compaction in spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Tssk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01105:Tssk6 APN 8 69902812 missense probably benign 0.33
IGL02966:Tssk6 APN 8 69902885 missense probably benign 0.13
R4946:Tssk6 UTSW 8 69903064 missense probably benign 0.00
R6870:Tssk6 UTSW 8 69903023 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACAAGTTCCTGCCTCGAGAG -3'
(R):5'- ACACGTCGTATTTCTTAGGGTC -3'

Sequencing Primer
(F):5'- TCGAGAGCTGTCCATCCTG -3'
(R):5'- ACCTCAGGTGACGCATACG -3'
Posted On2016-07-22