Incidental Mutation 'R5300:Mfsd4b1'
ID405608
Institutional Source Beutler Lab
Gene Symbol Mfsd4b1
Ensembl Gene ENSMUSG00000038522
Gene Namemajor facilitator superfamily domain containing 4B1
SynonymsAI317395
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location40001575-40025268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 40003031 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 290 (F290C)
Ref Sequence ENSEMBL: ENSMUSP00000128324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163705]
Predicted Effect probably benign
Transcript: ENSMUST00000163705
AA Change: F290C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128324
Gene: ENSMUSG00000038522
AA Change: F290C

DomainStartEndE-ValueType
Pfam:MFS_1 1 369 1.9e-15 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176975
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Mfsd4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Mfsd4b1 APN 10 40003119 missense probably benign 0.16
IGL03356:Mfsd4b1 APN 10 40002831 missense probably damaging 0.97
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1770:Mfsd4b1 UTSW 10 40003227 missense probably damaging 0.99
R1930:Mfsd4b1 UTSW 10 40006074 missense probably benign 0.01
R2122:Mfsd4b1 UTSW 10 40002651 missense possibly damaging 0.91
R2290:Mfsd4b1 UTSW 10 40003331 missense probably damaging 0.99
R3508:Mfsd4b1 UTSW 10 40002719 missense probably benign 0.15
R4469:Mfsd4b1 UTSW 10 40012095 intron probably benign
R4594:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R6250:Mfsd4b1 UTSW 10 40003110 missense possibly damaging 0.92
R6426:Mfsd4b1 UTSW 10 40006077 missense possibly damaging 0.95
R7061:Mfsd4b1 UTSW 10 40003386 missense possibly damaging 0.83
R7595:Mfsd4b1 UTSW 10 40003225 nonsense probably null
R7734:Mfsd4b1 UTSW 10 40007378 missense probably damaging 0.98
R7737:Mfsd4b1 UTSW 10 40003278 missense probably damaging 0.97
R7852:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7893:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R7935:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7976:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
X0063:Mfsd4b1 UTSW 10 40007307 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAGATTTCCCAGTTAAGGTGG -3'
(R):5'- AGGGCTAAATATCACAGGGCC -3'

Sequencing Primer
(F):5'- GTGTACTGCTCAATCCAGGAG -3'
(R):5'- GGCCCTGCTATGCCTGC -3'
Posted On2016-07-22