Incidental Mutation 'R5300:Sppl2c'
ID405610
Institutional Source Beutler Lab
Gene Symbol Sppl2c
Ensembl Gene ENSMUSG00000049506
Gene Namesignal peptide peptidase 2C
Synonyms
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location104186327-104191163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104187075 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 234 (N234Y)
Ref Sequence ENSEMBL: ENSMUSP00000102613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059448] [ENSMUST00000107000]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059448
AA Change: N234Y

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091453
Gene: ENSMUSG00000049506
AA Change: N234Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 1.8e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107000
AA Change: N234Y

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102613
Gene: ENSMUSG00000049506
AA Change: N234Y

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:PA 62 169 2.3e-8 PFAM
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 220 237 N/A INTRINSIC
PSN 256 528 1.08e-95 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Cfap58 A T 19: 47,941,156 I19F probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Sppl2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Sppl2c APN 11 104186979 missense possibly damaging 0.83
IGL02326:Sppl2c APN 11 104187273 missense probably benign 0.27
IGL02479:Sppl2c APN 11 104186937 missense probably benign
H8786:Sppl2c UTSW 11 104186865 missense probably benign 0.04
R0083:Sppl2c UTSW 11 104186532 missense probably benign 0.00
R1625:Sppl2c UTSW 11 104187169 missense probably damaging 0.98
R1913:Sppl2c UTSW 11 104187889 missense probably benign 0.15
R2037:Sppl2c UTSW 11 104186481 missense probably benign 0.23
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2869:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2871:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R2873:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3009:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3010:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R3011:Sppl2c UTSW 11 104187315 missense probably benign 0.21
R4698:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4718:Sppl2c UTSW 11 104188315 missense probably benign 0.21
R4841:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R4842:Sppl2c UTSW 11 104187652 missense probably benign 0.06
R5248:Sppl2c UTSW 11 104186581 missense possibly damaging 0.88
R5288:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5384:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5386:Sppl2c UTSW 11 104187301 missense possibly damaging 0.68
R5427:Sppl2c UTSW 11 104187867 missense probably benign 0.01
R5452:Sppl2c UTSW 11 104187300 missense probably benign
R5796:Sppl2c UTSW 11 104187793 missense probably benign 0.00
R6112:Sppl2c UTSW 11 104187137 missense probably benign 0.00
R6452:Sppl2c UTSW 11 104188191 missense probably benign 0.01
R6476:Sppl2c UTSW 11 104186769 missense probably benign
R7368:Sppl2c UTSW 11 104187604 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTGGACATTGTCAGCCACAC -3'
(R):5'- TGGCACCCAGGCTAAAGATC -3'

Sequencing Primer
(F):5'- ATTGTCAGCCACACTTACGG -3'
(R):5'- GGCTAAAGATCCCAATCATGACGTAG -3'
Posted On2016-07-22