Mutagenetix > Incidental Mutations

Incidental Mutation 'R5300:Cfap58'

405621

Institutional Source

Beutler Lab

Gene Symbol

Cfap58

Ensembl Gene

ENSMUSG00000046585

Gene Name

cilia and flagella associated protein 58

Synonyms

LOC381229, Ccdc147

MMRRC Submission

042883-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.263) question?

Stock #

R5300 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47937712-48035379 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 47941156 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 19 (I19F)

Ref Sequence

ENSEMBL: ENSMUSP00000070533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066308]

Predicted Effect

probably benign
Transcript: ENSMUST00000066308
AA Change: I19F

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: I19F

Domain	Start	End	E-Value	Type
coiled coil region	106	579	N/A	INTRINSIC
coiled coil region	642	706	N/A	INTRINSIC
low complexity region	740	762	N/A	INTRINSIC
coiled coil region	772	832	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AF529169	A	T	9: 89,603,199	S48R	probably damaging	Het
Ank1	A	G	8: 23,132,501	K1644E	probably benign	Het
C7	C	A	15: 5,031,950	G306W	probably damaging	Het
Ccdc185	A	G	1: 182,748,080	V348A	probably benign	Het
Dnaaf2	C	G	12: 69,198,228	V20L	probably damaging	Het
Dpy19l3	A	G	7: 35,727,310	Y58H	probably damaging	Het
Dsc1	T	C	18: 20,094,860	S480G	probably damaging	Het
Eno4	G	A	19: 58,955,550		probably null	Het
Gm136	T	G	4: 34,750,930	K114N	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc37a	T	A	11: 103,456,958	L2970F	unknown	Het
Ly86	C	T	13: 37,418,612	T160I	probably benign	Het
Mfsd4b1	A	C	10: 40,003,031	F290C	probably benign	Het
Nbeal1	T	G	1: 60,235,559	Y376*	probably null	Het
Nipbl	A	T	15: 8,351,497	S604T	probably benign	Het
Pml	A	C	9: 58,247,019	N190K	probably damaging	Het
Rin3	C	A	12: 102,369,670	F533L	probably benign	Het
Scamp1	A	G	13: 94,204,162	V233A	probably damaging	Het
Sppl2c	A	T	11: 104,187,075	N234Y	possibly damaging	Het
Tfap2b	A	G	1: 19,228,453	K278R	probably damaging	Het
Tg	A	G	15: 66,678,855	Y278C	probably damaging	Het
Trdn	A	G	10: 33,195,982	E215G	probably damaging	Het
Tssk6	T	C	8: 69,902,635	S110P	probably benign	Het
Vmn2r15	A	T	5: 109,294,108	L153Q	probably damaging	Het
Wdr17	C	T	8: 54,681,399	G349R	probably damaging	Het
Zfp667	A	G	7: 6,304,636	H101R	probably benign	Het
Zfp772	A	T	7: 7,204,158	M178K	probably benign	Het

Other mutations in Cfap58

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01688:Cfap58	APN	19	47974567	missense	probably benign	0.30
IGL02068:Cfap58	APN	19	47986512	missense	probably damaging	1.00
IGL02609:Cfap58	APN	19	47975502	missense	possibly damaging	0.80
IGL03376:Cfap58	APN	19	48034725	missense	possibly damaging	0.60
PIT4515001:Cfap58	UTSW	19	48034683	missense	probably benign
PIT4618001:Cfap58	UTSW	19	47975514	missense	probably damaging	1.00
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0015:Cfap58	UTSW	19	48029100	missense	probably benign	0.45
R0454:Cfap58	UTSW	19	47974680	critical splice donor site	probably null
R0545:Cfap58	UTSW	19	47941097	splice site	probably benign
R0789:Cfap58	UTSW	19	47955309	missense	probably benign	0.09
R0926:Cfap58	UTSW	19	47962562	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1148:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1462:Cfap58	UTSW	19	47962430	missense	probably damaging	1.00
R1493:Cfap58	UTSW	19	47988504	missense	probably damaging	0.96
R1541:Cfap58	UTSW	19	47983530	missense	probably damaging	1.00
R1629:Cfap58	UTSW	19	47941339	missense	probably benign	0.02
R1648:Cfap58	UTSW	19	47955405	missense	probably benign	0.13
R1837:Cfap58	UTSW	19	48029139	missense	probably damaging	0.98
R2307:Cfap58	UTSW	19	47962486	nonsense	probably null
R2513:Cfap58	UTSW	19	47962542	missense	probably benign	0.03
R3802:Cfap58	UTSW	19	47953059	missense	possibly damaging	0.81
R4233:Cfap58	UTSW	19	47975555	missense	possibly damaging	0.60
R4258:Cfap58	UTSW	19	47949484	splice site	probably null
R4414:Cfap58	UTSW	19	47953041	missense	possibly damaging	0.87
R4763:Cfap58	UTSW	19	47983506	missense	probably damaging	1.00
R5406:Cfap58	UTSW	19	48029102	missense	possibly damaging	0.81
R5497:Cfap58	UTSW	19	48029109	missense	probably benign	0.08
R5635:Cfap58	UTSW	19	47983542	missense	possibly damaging	0.47
R6315:Cfap58	UTSW	19	47941277	missense	probably benign	0.40
R6483:Cfap58	UTSW	19	47983452	missense	probably benign	0.00
R6727:Cfap58	UTSW	19	47955417	missense	probably benign	0.30
R6896:Cfap58	UTSW	19	47944187	missense	probably damaging	0.98
R7461:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7473:Cfap58	UTSW	19	47974625	nonsense	probably null
R7613:Cfap58	UTSW	19	47982122	missense	possibly damaging	0.70
R7650:Cfap58	UTSW	19	47986528	missense	possibly damaging	0.84
R7982:Cfap58	UTSW	19	47974567	missense	probably benign	0.30
R8083:Cfap58	UTSW	19	47983518	missense	probably damaging	1.00
R8121:Cfap58	UTSW	19	48029104	missense	probably benign	0.40
R8321:Cfap58	UTSW	19	47958147	missense	probably damaging	0.99
R8396:Cfap58	UTSW	19	48029101	missense	probably damaging	1.00
R8462:Cfap58	UTSW	19	47983650	missense	possibly damaging	0.94
X0067:Cfap58	UTSW	19	47955308	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAATATTTCTGCTAGCTGGCGG -3'
(R):5'- GCCGAGTTCACCACAATCTCTG -3'

Sequencing Primer
(F):5'- GTACCATCAGCCACGTGCATG -3'
(R):5'- ACCACAATCTCTGCGTTCAG -3'

Posted On

2016-07-22