Incidental Mutation 'R5300:Cfap58'
ID405621
Institutional Source Beutler Lab
Gene Symbol Cfap58
Ensembl Gene ENSMUSG00000046585
Gene Namecilia and flagella associated protein 58
SynonymsLOC381229, Ccdc147
MMRRC Submission 042883-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5300 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47937712-48035379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 47941156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 19 (I19F)
Ref Sequence ENSEMBL: ENSMUSP00000070533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066308]
Predicted Effect probably benign
Transcript: ENSMUST00000066308
AA Change: I19F

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070533
Gene: ENSMUSG00000046585
AA Change: I19F

DomainStartEndE-ValueType
coiled coil region 106 579 N/A INTRINSIC
coiled coil region 642 706 N/A INTRINSIC
low complexity region 740 762 N/A INTRINSIC
coiled coil region 772 832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AF529169 A T 9: 89,603,199 S48R probably damaging Het
Ank1 A G 8: 23,132,501 K1644E probably benign Het
C7 C A 15: 5,031,950 G306W probably damaging Het
Ccdc185 A G 1: 182,748,080 V348A probably benign Het
Dnaaf2 C G 12: 69,198,228 V20L probably damaging Het
Dpy19l3 A G 7: 35,727,310 Y58H probably damaging Het
Dsc1 T C 18: 20,094,860 S480G probably damaging Het
Eno4 G A 19: 58,955,550 probably null Het
Gm136 T G 4: 34,750,930 K114N probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc37a T A 11: 103,456,958 L2970F unknown Het
Ly86 C T 13: 37,418,612 T160I probably benign Het
Mfsd4b1 A C 10: 40,003,031 F290C probably benign Het
Nbeal1 T G 1: 60,235,559 Y376* probably null Het
Nipbl A T 15: 8,351,497 S604T probably benign Het
Pml A C 9: 58,247,019 N190K probably damaging Het
Rin3 C A 12: 102,369,670 F533L probably benign Het
Scamp1 A G 13: 94,204,162 V233A probably damaging Het
Sppl2c A T 11: 104,187,075 N234Y possibly damaging Het
Tfap2b A G 1: 19,228,453 K278R probably damaging Het
Tg A G 15: 66,678,855 Y278C probably damaging Het
Trdn A G 10: 33,195,982 E215G probably damaging Het
Tssk6 T C 8: 69,902,635 S110P probably benign Het
Vmn2r15 A T 5: 109,294,108 L153Q probably damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp667 A G 7: 6,304,636 H101R probably benign Het
Zfp772 A T 7: 7,204,158 M178K probably benign Het
Other mutations in Cfap58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cfap58 APN 19 47974567 missense probably benign 0.30
IGL02068:Cfap58 APN 19 47986512 missense probably damaging 1.00
IGL02609:Cfap58 APN 19 47975502 missense possibly damaging 0.80
IGL03376:Cfap58 APN 19 48034725 missense possibly damaging 0.60
PIT4515001:Cfap58 UTSW 19 48034683 missense probably benign
PIT4618001:Cfap58 UTSW 19 47975514 missense probably damaging 1.00
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0015:Cfap58 UTSW 19 48029100 missense probably benign 0.45
R0454:Cfap58 UTSW 19 47974680 critical splice donor site probably null
R0545:Cfap58 UTSW 19 47941097 splice site probably benign
R0789:Cfap58 UTSW 19 47955309 missense probably benign 0.09
R0926:Cfap58 UTSW 19 47962562 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1148:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1462:Cfap58 UTSW 19 47962430 missense probably damaging 1.00
R1493:Cfap58 UTSW 19 47988504 missense probably damaging 0.96
R1541:Cfap58 UTSW 19 47983530 missense probably damaging 1.00
R1629:Cfap58 UTSW 19 47941339 missense probably benign 0.02
R1648:Cfap58 UTSW 19 47955405 missense probably benign 0.13
R1837:Cfap58 UTSW 19 48029139 missense probably damaging 0.98
R2307:Cfap58 UTSW 19 47962486 nonsense probably null
R2513:Cfap58 UTSW 19 47962542 missense probably benign 0.03
R3802:Cfap58 UTSW 19 47953059 missense possibly damaging 0.81
R4233:Cfap58 UTSW 19 47975555 missense possibly damaging 0.60
R4258:Cfap58 UTSW 19 47949484 splice site probably null
R4414:Cfap58 UTSW 19 47953041 missense possibly damaging 0.87
R4763:Cfap58 UTSW 19 47983506 missense probably damaging 1.00
R5406:Cfap58 UTSW 19 48029102 missense possibly damaging 0.81
R5497:Cfap58 UTSW 19 48029109 missense probably benign 0.08
R5635:Cfap58 UTSW 19 47983542 missense possibly damaging 0.47
R6315:Cfap58 UTSW 19 47941277 missense probably benign 0.40
R6483:Cfap58 UTSW 19 47983452 missense probably benign 0.00
R6727:Cfap58 UTSW 19 47955417 missense probably benign 0.30
R6896:Cfap58 UTSW 19 47944187 missense probably damaging 0.98
R7461:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7473:Cfap58 UTSW 19 47974625 nonsense probably null
R7613:Cfap58 UTSW 19 47982122 missense possibly damaging 0.70
R7650:Cfap58 UTSW 19 47986528 missense possibly damaging 0.84
X0067:Cfap58 UTSW 19 47955308 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATATTTCTGCTAGCTGGCGG -3'
(R):5'- GCCGAGTTCACCACAATCTCTG -3'

Sequencing Primer
(F):5'- GTACCATCAGCCACGTGCATG -3'
(R):5'- ACCACAATCTCTGCGTTCAG -3'
Posted On2016-07-22