Incidental Mutation 'R5312:Myog'
ID 405623
Institutional Source Beutler Lab
Gene Symbol Myog
Ensembl Gene ENSMUSG00000026459
Gene Name myogenin
Synonyms myo, bHLHc3
MMRRC Submission 042895-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5312 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 134289989-134292548 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134290326 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 91 (K91E)
Ref Sequence ENSEMBL: ENSMUSP00000027730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027730]
AlphaFold P12979
Predicted Effect probably damaging
Transcript: ENSMUST00000027730
AA Change: K91E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027730
Gene: ENSMUSG00000026459
AA Change: K91E

DomainStartEndE-ValueType
BASIC 1 86 7.02e-46 SMART
HLH 87 138 3.43e-13 SMART
Meta Mutation Damage Score 0.7999 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myogenin is a muscle-specific transcription factor that can induce myogenesis in a variety of cell types in tissue culture. It is a member of a large family of proteins related by sequence homology, the helix-loop-helix (HLH) proteins. It is essential for the development of functional skeletal muscle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a severe reduction in muscle mass associated with delayed primary myogenesis and very little secondary myofiber formation, defects of the thoracic skeleton, and perinatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Myog
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Myog UTSW 1 134290235 missense probably damaging 0.99
R0013:Myog UTSW 1 134290235 missense probably damaging 0.99
R0533:Myog UTSW 1 134290473 missense possibly damaging 0.82
R5309:Myog UTSW 1 134290326 missense probably damaging 0.99
R6455:Myog UTSW 1 134290488 missense probably benign 0.38
R7730:Myog UTSW 1 134291176 critical splice donor site probably null
R9285:Myog UTSW 1 134291157 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GGGGAAAACTACCTTCCTGTCC -3'
(R):5'- ACTAGCCACTTACCATGGGC -3'

Sequencing Primer
(F):5'- TCCACCTTCAGGGCTTCGAG -3'
(R):5'- CCGCCTCTGTAGCGGAGATC -3'
Posted On 2016-07-22