Incidental Mutation 'R5312:Olfr1284'
ID405628
Institutional Source Beutler Lab
Gene Symbol Olfr1284
Ensembl Gene ENSMUSG00000108931
Gene Nameolfactory receptor 1284
SynonymsMOR245-13, GA_x6K02T2Q125-72430580-72431515
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111375522-111380613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111379834 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 278 (V278A)
Ref Sequence ENSEMBL: ENSMUSP00000147014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062407] [ENSMUST00000209096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062407
AA Change: V278A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052153
Gene: ENSMUSG00000108931
AA Change: V278A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 7.2e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 302 2.4e-5 PFAM
Pfam:7tm_1 41 287 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209096
AA Change: V278A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Olfr1284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03024:Olfr1284 APN 2 111379590 missense possibly damaging 0.94
R0526:Olfr1284 UTSW 2 111379492 missense possibly damaging 0.95
R0731:Olfr1284 UTSW 2 111379293 missense probably damaging 0.99
R1762:Olfr1284 UTSW 2 111379573 missense probably damaging 0.99
R1765:Olfr1284 UTSW 2 111379146 missense probably benign 0.39
R3106:Olfr1284 UTSW 2 111379495 missense probably benign 0.23
R3803:Olfr1284 UTSW 2 111379293 missense possibly damaging 0.95
R3894:Olfr1284 UTSW 2 111379637 missense probably benign 0.09
R4005:Olfr1284 UTSW 2 111379743 missense probably benign 0.05
R4227:Olfr1284 UTSW 2 111379065 missense probably benign
R4637:Olfr1284 UTSW 2 111379582 missense probably benign 0.03
R4707:Olfr1284 UTSW 2 111379645 missense probably damaging 1.00
R4762:Olfr1284 UTSW 2 111379737 missense probably damaging 1.00
R5150:Olfr1284 UTSW 2 111379253 missense probably damaging 1.00
R5309:Olfr1284 UTSW 2 111379834 missense possibly damaging 0.52
R6554:Olfr1284 UTSW 2 111379159 missense possibly damaging 0.95
R6913:Olfr1284 UTSW 2 111379002 start codon destroyed probably null 0.03
R6980:Olfr1284 UTSW 2 111379275 missense possibly damaging 0.77
R6995:Olfr1284 UTSW 2 111379363 missense probably damaging 1.00
R7168:Olfr1284 UTSW 2 111379879 missense probably damaging 1.00
R7332:Olfr1284 UTSW 2 111379393 missense not run
R7464:Olfr1284 UTSW 2 111379198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCTTCATGACCTTGGG -3'
(R):5'- CCTGAACAACATGTTAACTGGAG -3'

Sequencing Primer
(F):5'- TATGTCTTCATTTTGGTCACAGTCTG -3'
(R):5'- GAACAACATGTTAACTGGAGATGTC -3'
Posted On2016-07-22