Mutagenetix > Incidental Mutation

Incidental Mutation 'R5312:Adnp'

405629

Institutional Source

Beutler Lab

Gene Symbol

Adnp

Ensembl Gene

ENSMUSG00000051149

Gene Name

activity-dependent neuroprotective protein

Synonyms

mKIAA0784

MMRRC Submission

042895-MU

Accession Numbers

Genbank: NM_009628; MGI: 1338758

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

168180986-168207112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 168184188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 396 (T396A)

Ref Sequence

ENSEMBL: ENSMUSP00000085316 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057793] [ENSMUST00000088001] [ENSMUST00000138667]

AlphaFold

Q9Z103

Predicted Effect

probably benign
Transcript: ENSMUST00000057793
AA Change: T396A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000056809
Gene: ENSMUSG00000051149
AA Change: T396A

Domain	Start	End	E-Value	Type
ZnF_C2H2	74	97	6.57e0	SMART
ZnF_C2H2	107	129	1.77e1	SMART
low complexity region	130	141	N/A	INTRINSIC
ZnF_C2H2	165	188	1.29e1	SMART
ZnF_C2H2	221	244	1.4e1	SMART
low complexity region	423	437	N/A	INTRINSIC
ZnF_C2H2	446	468	8.62e1	SMART
ZnF_C2H2	488	509	2.54e1	SMART
ZnF_C2H2	511	534	1.03e-2	SMART
low complexity region	582	596	N/A	INTRINSIC
ZnF_C2H2	621	646	1.27e2	SMART
HOX	756	817	2.95e-6	SMART
low complexity region	957	970	N/A	INTRINSIC
low complexity region	1012	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000088001
AA Change: T396A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000085316
Gene: ENSMUSG00000051149
AA Change: T396A

Domain	Start	End	E-Value	Type
ZnF_C2H2	74	97	6.57e0	SMART
ZnF_C2H2	107	129	1.77e1	SMART
low complexity region	130	141	N/A	INTRINSIC
ZnF_C2H2	165	188	1.29e1	SMART
ZnF_C2H2	221	244	1.4e1	SMART
low complexity region	423	437	N/A	INTRINSIC
ZnF_C2H2	446	468	8.62e1	SMART
ZnF_C2H2	488	509	2.54e1	SMART
ZnF_C2H2	511	534	1.03e-2	SMART
low complexity region	582	596	N/A	INTRINSIC
ZnF_C2H2	621	646	1.27e2	SMART
HOX	756	817	2.95e-6	SMART
low complexity region	957	970	N/A	INTRINSIC
low complexity region	1012	1023	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138667

SMART Domains

Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

Domain	Start	End	E-Value	Type
Pfam:Glyco_tranf_2_3	24	240	1.1e-13	PFAM
Pfam:Glyco_tranf_2_2	28	153	8.4e-10	PFAM
Pfam:Glycos_transf_2	28	199	3.8e-40	PFAM
Pfam:Glyco_transf_21	87	200	1.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139984

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: This gene encodes a member of a protein family characterized by nine zinc finger motifs followed by a homeobox domain. In vitro studies demonstrate that the encoded protein interacts with the brahma-related gene1-associated or hBRM factors (BAF) gene expression regulating complex, components of the protein translation machinery, and microtubule-associated proteins. This gene has been implicated in neuroprotection through various processes that include chromatin remodeling, splicing, cytoskeletal reorganization, and autophagy. Homozygous mutant knockout mice display embryonic lethality with defects in neural tube closure. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Developmental defects including the failure of the cranial neural tube to close lead to embryonic death between E8.5 and E9. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Adnp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Adnp	APN	2	168182562	missense	probably benign
IGL00500:Adnp	APN	2	168183323	missense	possibly damaging	0.85
IGL01604:Adnp	APN	2	168184338	missense	probably damaging	0.99
IGL01967:Adnp	APN	2	168183419	missense	possibly damaging	0.85
IGL02470:Adnp	APN	2	168183194	missense	probably damaging	0.99
C9142:Adnp	UTSW	2	168184407	missense	probably damaging	0.99
R0893:Adnp	UTSW	2	168183727	missense	possibly damaging	0.85
R1167:Adnp	UTSW	2	168184500	missense	probably benign	0.11
R1182:Adnp	UTSW	2	168184796	missense	possibly damaging	0.77
R1480:Adnp	UTSW	2	168183534	missense	probably damaging	0.99
R1505:Adnp	UTSW	2	168183741	missense	possibly damaging	0.93
R1906:Adnp	UTSW	2	168182367	missense	probably benign
R3711:Adnp	UTSW	2	168184823	missense	probably damaging	0.98
R3943:Adnp	UTSW	2	168185060	missense	possibly damaging	0.92
R4440:Adnp	UTSW	2	168184801	missense	possibly damaging	0.92
R4686:Adnp	UTSW	2	168182389	missense	possibly damaging	0.78
R4916:Adnp	UTSW	2	168187617	missense	possibly damaging	0.91
R5072:Adnp	UTSW	2	168183001	missense	probably damaging	0.96
R5393:Adnp	UTSW	2	168182949	missense	possibly damaging	0.95
R5598:Adnp	UTSW	2	168183725	missense	probably damaging	0.99
R6230:Adnp	UTSW	2	168182532	missense	probably benign
R7165:Adnp	UTSW	2	168182367	missense	probably benign	0.07
R7176:Adnp	UTSW	2	168182658	missense	probably benign
R7238:Adnp	UTSW	2	168183967	missense	probably damaging	1.00
R7254:Adnp	UTSW	2	168183998	missense	probably damaging	0.99
R7581:Adnp	UTSW	2	168183466	missense	probably damaging	0.96
R7676:Adnp	UTSW	2	168183447	nonsense	probably null
R7863:Adnp	UTSW	2	168189350	missense	possibly damaging	0.91
R8098:Adnp	UTSW	2	168182532	missense	probably benign
R8196:Adnp	UTSW	2	168183172	missense	probably benign
R8970:Adnp	UTSW	2	168189370	missense	possibly damaging	0.91
R9153:Adnp	UTSW	2	168184660	missense	possibly damaging	0.96
R9154:Adnp	UTSW	2	168184660	missense	possibly damaging	0.96
R9228:Adnp	UTSW	2	168184878	missense	probably damaging	0.98
R9256:Adnp	UTSW	2	168184025	missense	probably damaging	1.00
R9268:Adnp	UTSW	2	168189313	missense	possibly damaging	0.86
R9434:Adnp	UTSW	2	168184457	missense	probably damaging	0.99
R9517:Adnp	UTSW	2	168182946	missense	possibly damaging	0.93
R9621:Adnp	UTSW	2	168182743	missense	probably benign	0.22
R9669:Adnp	UTSW	2	168184998	missense	possibly damaging	0.91
R9737:Adnp	UTSW	2	168184998	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TTCGAAGTGAACGCTATAGACATTC -3'
(R):5'- TGGAGTCAAATCTGTGGGCC -3'

Sequencing Primer
(F):5'- TCTCAGGGAAAAGCTCGTTAC -3'
(R):5'- CCAGAGCTATGGTGTTGGCC -3'

Posted On

2016-07-22