Mutagenetix > Incidental Mutation

Incidental Mutation 'R5312:Sema4a'

405631

Institutional Source

Beutler Lab

Gene Symbol

Sema4a

Ensembl Gene

ENSMUSG00000028064

Gene Name

sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A

Synonyms

SemB, Semab, SemB

MMRRC Submission

042895-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.899) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88435959-88461182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 88437036 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 636 (S636F)

Ref Sequence

ENSEMBL: ENSMUSP00000128887 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029700] [ENSMUST00000107531] [ENSMUST00000165898] [ENSMUST00000166237] [ENSMUST00000169222]

AlphaFold

Q62178

Predicted Effect

probably damaging
Transcript: ENSMUST00000029700
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029700
Gene: ENSMUSG00000028064
AA Change: S636F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107531
AA Change: S504F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103155
Gene: ENSMUSG00000028064
AA Change: S504F

Domain	Start	End	E-Value	Type
Sema	2	346	2.06e-101	SMART
PSI	364	415	9.33e-13	SMART
transmembrane domain	548	570	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135539

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149145

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156108

Predicted Effect

probably damaging
Transcript: ENSMUST00000165898
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128510
Gene: ENSMUSG00000028064
AA Change: S636F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166237
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125909
Gene: ENSMUSG00000028064
AA Change: S636F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169222
AA Change: S636F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128887
Gene: ENSMUSG00000028064
AA Change: S636F

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Sema	64	478	1.96e-166	SMART
PSI	496	547	9.33e-13	SMART
transmembrane domain	680	702	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183768

Meta Mutation Damage Score

0.2595

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family of soluble and transmembrane proteins. Semaphorins are involved in numerous functions, including axon guidance, morphogenesis, carcinogenesis, and immunomodulation. The encoded protein is a single-pass type I membrane protein containing an immunoglobulin-like C2-type domain, a PSI domain and a sema domain. It inhibits axonal extension by providing local signals to specify territories inaccessible for growing axons. It is an activator of T-cell-mediated immunity and suppresses vascular endothelial growth factor (VEGF)-mediated endothelial cell migration and proliferation in vitro and angiogenesis in vivo. Mutations in this gene are associated with retinal degenerative diseases including retinitis pigmentosa type 35 (RP35) and cone-rod dystrophy type 10 (CORD10). Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a knock-out allele show no obvious brain defects but exhibit impaired T cell priming and defective Th1 responses. Homozygotes for a gene trap allele show severe retinal degeneration with reduced retinal vessels, depigmentation and dysfunction of both rod and cone photoreceptors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Sema4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Sema4a	APN	3	88449810	missense	probably damaging	1.00
IGL01722:Sema4a	APN	3	88438184	missense	probably benign	0.14
IGL01769:Sema4a	APN	3	88449756	missense	possibly damaging	0.86
IGL02076:Sema4a	APN	3	88450522	missense	probably damaging	0.99
IGL02202:Sema4a	APN	3	88449743	missense	probably damaging	1.00
R0145:Sema4a	UTSW	3	88451422	missense	probably damaging	1.00
R0386:Sema4a	UTSW	3	88436800	missense	possibly damaging	0.75
R0837:Sema4a	UTSW	3	88453098	missense	possibly damaging	0.46
R0863:Sema4a	UTSW	3	88448149	unclassified	probably benign
R1567:Sema4a	UTSW	3	88452046	missense	probably damaging	1.00
R1675:Sema4a	UTSW	3	88454766	missense	possibly damaging	0.66
R1739:Sema4a	UTSW	3	88436838	missense	possibly damaging	0.94
R1801:Sema4a	UTSW	3	88436749	missense	probably benign	0.04
R1961:Sema4a	UTSW	3	88438176	splice site	probably benign
R2029:Sema4a	UTSW	3	88451361	missense	probably damaging	1.00
R4934:Sema4a	UTSW	3	88438261	missense	probably damaging	1.00
R5006:Sema4a	UTSW	3	88436784	missense	probably benign
R5309:Sema4a	UTSW	3	88437036	missense	probably damaging	1.00
R5338:Sema4a	UTSW	3	88451497	missense	probably benign	0.01
R5481:Sema4a	UTSW	3	88453040	nonsense	probably null
R5510:Sema4a	UTSW	3	88449986	critical splice donor site	probably null
R6046:Sema4a	UTSW	3	88440701	missense	probably damaging	1.00
R7242:Sema4a	UTSW	3	88450109	missense	probably damaging	1.00
R8403:Sema4a	UTSW	3	88452034	missense	probably damaging	0.98
R8798:Sema4a	UTSW	3	88436697	missense	possibly damaging	0.76
R9328:Sema4a	UTSW	3	88438306	nonsense	probably null
R9638:Sema4a	UTSW	3	88449759	missense	probably damaging	1.00
R9728:Sema4a	UTSW	3	88440880	critical splice acceptor site	probably null
Z1176:Sema4a	UTSW	3	88437193	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCAGTGGAGCCTTTTCCCTG -3'
(R):5'- TTAAAGAAGTCCTGACAGTCCC -3'

Sequencing Primer
(F):5'- ACTCCCAGGAGCACGATG -3'
(R):5'- TCCATCCTGGAGCTGCC -3'

Posted On

2016-07-22