Incidental Mutation 'R5312:Fancg'
ID405635
Institutional Source Beutler Lab
Gene Symbol Fancg
Ensembl Gene ENSMUSG00000028453
Gene NameFanconi anemia, complementation group G
SynonymsXrcc9
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43002343-43010506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43003019 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 613 (F613L)
Ref Sequence ENSEMBL: ENSMUSP00000030165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030164] [ENSMUST00000030165]
Predicted Effect probably benign
Transcript: ENSMUST00000030164
SMART Domains Protein: ENSMUSP00000030164
Gene: ENSMUSG00000028452

DomainStartEndE-ValueType
CDC48_N 25 108 6.85e-27 SMART
CDC48_2 125 191 3.77e-15 SMART
AAA 237 373 7.87e-24 SMART
AAA 510 649 2e-25 SMART
Pfam:Vps4_C 710 762 3.5e-7 PFAM
low complexity region 775 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030165
AA Change: F613L

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000030165
Gene: ENSMUSG00000028453
AA Change: F613L

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
low complexity region 190 199 N/A INTRINSIC
Pfam:TPR_1 251 280 4.1e-6 PFAM
Pfam:TPR_2 251 281 7.3e-5 PFAM
Pfam:TPR_8 251 281 4.5e-3 PFAM
low complexity region 302 317 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Blast:TPR 458 491 4e-9 BLAST
Blast:TPR 518 550 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148182
Meta Mutation Damage Score 0.1162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females and males homozygous for targeted null mutations exhibit hypogonadism and reduced fertility. Cytogeneic analysis showed somatic chromosome aberrations occur at a higher spontaneous rate and are easier to induce than in normal cells. Cells are also more sensitive to mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Fancg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Fancg APN 4 43003910 nonsense probably null
IGL02072:Fancg APN 4 43007062 missense probably benign 0.00
IGL02184:Fancg APN 4 43006872 missense possibly damaging 0.79
IGL02989:Fancg APN 4 43007121 splice site probably benign
R0671:Fancg UTSW 4 43002998 missense probably benign 0.00
R1581:Fancg UTSW 4 43007039 missense probably damaging 1.00
R1853:Fancg UTSW 4 43009727 missense probably benign 0.00
R2046:Fancg UTSW 4 43004604 missense probably damaging 1.00
R2519:Fancg UTSW 4 43008787 missense probably damaging 1.00
R4282:Fancg UTSW 4 43003830 missense probably damaging 1.00
R4397:Fancg UTSW 4 43008897 missense probably benign 0.02
R4583:Fancg UTSW 4 43002991 missense probably benign
R4671:Fancg UTSW 4 43005272 missense probably benign 0.01
R4887:Fancg UTSW 4 43006866 missense probably benign 0.18
R5309:Fancg UTSW 4 43003019 missense probably benign 0.23
R5325:Fancg UTSW 4 43006564 missense probably damaging 0.99
R5379:Fancg UTSW 4 43002998 missense probably benign 0.00
R5386:Fancg UTSW 4 43007076 nonsense probably null
R5649:Fancg UTSW 4 43008736 missense probably damaging 1.00
R5788:Fancg UTSW 4 43007130 intron probably benign
R5802:Fancg UTSW 4 43006582 missense probably benign
R6217:Fancg UTSW 4 43010084 missense probably benign 0.03
R6698:Fancg UTSW 4 43007034 missense probably benign 0.00
R7092:Fancg UTSW 4 43004831 missense probably benign 0.03
R7527:Fancg UTSW 4 43010116 start gained probably benign
R7664:Fancg UTSW 4 43010066 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGAACTAGACTGGTAGCAAG -3'
(R):5'- TCTGTGCTTCTGAGACCTAGC -3'

Sequencing Primer
(F):5'- CTGGTAGCAAGTAGATCAAGGTTCAC -3'
(R):5'- CAGGTCTCTTCCACTGTAT -3'
Posted On2016-07-22