Mutagenetix > Incidental Mutation

Incidental Mutation 'R5312:Dmrta1'

405637

Institutional Source

Beutler Lab

Gene Symbol

Dmrta1

Ensembl Gene

ENSMUSG00000043753

Gene Name

doublesex and mab-3 related transcription factor like family A1

Synonyms

Dmrt4

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89679436-89694772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 89692047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 415 (N415H)

Ref Sequence

ENSEMBL: ENSMUSP00000057488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052478]

AlphaFold

Q8CFG4

Predicted Effect

probably damaging
Transcript: ENSMUST00000052478
AA Change: N415H

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: N415H

Domain	Start	End	E-Value	Type
low complexity region	20	37	N/A	INTRINSIC
DM	82	135	2.31e-30	SMART
low complexity region	151	165	N/A	INTRINSIC
Pfam:DMA	314	350	3.3e-21	PFAM
low complexity region	393	404	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131576

Meta Mutation Damage Score

0.1551

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Dmrta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02154:Dmrta1	APN	4	89691913	missense	probably benign	0.04
IGL02572:Dmrta1	APN	4	89691558	missense	probably benign	0.01
IGL02875:Dmrta1	APN	4	89691748	missense	possibly damaging	0.70
IGL02883:Dmrta1	APN	4	89688774	missense	probably benign
R0097:Dmrta1	UTSW	4	89688872	missense	probably benign	0.08
R0097:Dmrta1	UTSW	4	89688872	missense	probably benign	0.08
R0394:Dmrta1	UTSW	4	89692039	missense	probably damaging	1.00
R2093:Dmrta1	UTSW	4	89691505	missense	probably benign
R2132:Dmrta1	UTSW	4	89688709	missense	probably damaging	1.00
R2133:Dmrta1	UTSW	4	89688709	missense	probably damaging	1.00
R2401:Dmrta1	UTSW	4	89691616	missense	probably benign	0.00
R3694:Dmrta1	UTSW	4	89692178	nonsense	probably null
R3695:Dmrta1	UTSW	4	89692178	nonsense	probably null
R3891:Dmrta1	UTSW	4	89691594	missense	possibly damaging	0.93
R3892:Dmrta1	UTSW	4	89691594	missense	possibly damaging	0.93
R3929:Dmrta1	UTSW	4	89691444	nonsense	probably null
R4620:Dmrta1	UTSW	4	89688784	missense	probably benign	0.05
R4927:Dmrta1	UTSW	4	89691748	missense	probably damaging	1.00
R4982:Dmrta1	UTSW	4	89688564	missense	probably damaging	1.00
R5437:Dmrta1	UTSW	4	89691756	missense	possibly damaging	0.71
R5637:Dmrta1	UTSW	4	89688831	missense	probably benign
R6185:Dmrta1	UTSW	4	89691768	missense	probably damaging	0.97
R6906:Dmrta1	UTSW	4	89691966	missense	probably benign	0.06
R7156:Dmrta1	UTSW	4	89688463	missense	probably damaging	0.99
R7201:Dmrta1	UTSW	4	89692171	nonsense	probably null
R7755:Dmrta1	UTSW	4	89691933	missense	probably benign	0.01
R7862:Dmrta1	UTSW	4	89688324	missense	probably benign	0.00
R7880:Dmrta1	UTSW	4	89688844	missense	possibly damaging	0.95
R8714:Dmrta1	UTSW	4	89691445	missense	probably benign
R8841:Dmrta1	UTSW	4	89691713	missense	probably benign	0.00
R9028:Dmrta1	UTSW	4	89691677	missense	probably damaging	0.96
Z1177:Dmrta1	UTSW	4	89688408	missense	probably damaging	0.97
Z1177:Dmrta1	UTSW	4	89688454	missense	probably benign	0.37
Z1177:Dmrta1	UTSW	4	89688498	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- ACATAAACCCGACTGCAGGG -3'
(R):5'- CTCCTGATTGGGCCTGAAATACAG -3'

Sequencing Primer
(F):5'- ACTGCAGGGACCTAGCAC -3'
(R):5'- ACCAGCTACTAAGTGCTTGCTAGG -3'

Posted On

2016-07-22