Incidental Mutation 'R5312:Dnaaf5'
List |< first << previous [record 13 of 51] next >> last >|
ID405642
Institutional Source Beutler Lab
Gene Symbol Dnaaf5
Ensembl Gene ENSMUSG00000025857
Gene Namedynein, axonemal assembly factor 5
SynonymsHeatr2
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5312 (G1)
Quality Score216
Status Validated
Chromosome5
Chromosomal Location139150223-139186510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139152862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 266 (V266E)
Ref Sequence ENSEMBL: ENSMUSP00000026975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026975] [ENSMUST00000155833] [ENSMUST00000196441]
Predicted Effect probably damaging
Transcript: ENSMUST00000026975
AA Change: V266E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026975
Gene: ENSMUSG00000025857
AA Change: V266E

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 91 153 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
Pfam:Vac14_Fab1_bd 673 770 2.4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151512
Predicted Effect probably benign
Transcript: ENSMUST00000155833
SMART Domains Protein: ENSMUSP00000122693
Gene: ENSMUSG00000025855

DomainStartEndE-ValueType
RIIa 25 62 3.14e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196441
SMART Domains Protein: ENSMUSP00000142924
Gene: ENSMUSG00000025857

DomainStartEndE-ValueType
Pfam:Vac14_Fab1_bd 378 475 4.1e-5 PFAM
Pfam:HEAT 447 477 1.7e-3 PFAM
Meta Mutation Damage Score 0.6366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for the preassembly or stability of axonemal dynein arms, and is found only in organisms with motile cilia and flagella. Mutations in this gene are associated with primary ciliary dyskinesia-18, a disorder characterized by abnormalities of motile cilia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Dnaaf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dnaaf5 APN 5 139177946 missense probably benign 0.19
IGL00730:Dnaaf5 APN 5 139151668 critical splice donor site probably null
IGL01468:Dnaaf5 APN 5 139151480 splice site probably null
IGL02106:Dnaaf5 APN 5 139151513 missense probably damaging 1.00
IGL02273:Dnaaf5 APN 5 139177916 nonsense probably null
IGL02514:Dnaaf5 APN 5 139174117 splice site probably benign
IGL02572:Dnaaf5 APN 5 139184629 missense probably benign 0.00
IGL02699:Dnaaf5 APN 5 139153350 splice site probably benign
PIT4142001:Dnaaf5 UTSW 5 139185518 missense possibly damaging 0.91
PIT4283001:Dnaaf5 UTSW 5 139166162 missense probably benign 0.26
R0458:Dnaaf5 UTSW 5 139161878 missense possibly damaging 0.47
R2060:Dnaaf5 UTSW 5 139178003 missense probably damaging 1.00
R2162:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3833:Dnaaf5 UTSW 5 139181565 missense possibly damaging 0.46
R3944:Dnaaf5 UTSW 5 139152924 start gained probably benign
R4438:Dnaaf5 UTSW 5 139163392 missense probably damaging 1.00
R4534:Dnaaf5 UTSW 5 139151527 nonsense probably null
R4576:Dnaaf5 UTSW 5 139185639 missense probably damaging 0.98
R4581:Dnaaf5 UTSW 5 139184685 missense probably damaging 1.00
R4715:Dnaaf5 UTSW 5 139178000 missense probably damaging 0.99
R4791:Dnaaf5 UTSW 5 139184650 missense possibly damaging 0.56
R4868:Dnaaf5 UTSW 5 139170186 missense probably benign 0.01
R5011:Dnaaf5 UTSW 5 139163257 missense probably damaging 1.00
R5074:Dnaaf5 UTSW 5 139174207 missense probably damaging 1.00
R5137:Dnaaf5 UTSW 5 139181460 missense probably damaging 1.00
R5215:Dnaaf5 UTSW 5 139161877 missense probably benign 0.00
R5309:Dnaaf5 UTSW 5 139152862 missense probably damaging 0.99
R6632:Dnaaf5 UTSW 5 139170333 missense probably benign 0.04
R6863:Dnaaf5 UTSW 5 139151596 missense probably damaging 0.96
R7292:Dnaaf5 UTSW 5 139150317 missense unknown
R7439:Dnaaf5 UTSW 5 139166113 missense probably damaging 1.00
R7571:Dnaaf5 UTSW 5 139170208 missense possibly damaging 0.73
R7679:Dnaaf5 UTSW 5 139150637 missense unknown
R7706:Dnaaf5 UTSW 5 139152841 missense probably damaging 1.00
R7867:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
R7950:Dnaaf5 UTSW 5 139161810 missense probably damaging 1.00
X0020:Dnaaf5 UTSW 5 139163320 missense probably damaging 0.99
Z1177:Dnaaf5 UTSW 5 139177975 missense probably damaging 1.00
Z1177:Dnaaf5 UTSW 5 139185542 missense probably benign 0.04
Z1177:Dnaaf5 UTSW 5 139185585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACGGTATATTGCCAGGGG -3'
(R):5'- AGCAAAGCTCTTGTTCCAAATC -3'

Sequencing Primer
(F):5'- TATATTGCCAGGGGACAGTGAATCC -3'
(R):5'- AGCTCTTGTTCCAAATCAGGCAG -3'
Posted On2016-07-22