Incidental Mutation 'R5312:Abtb1'
ID405643
Institutional Source Beutler Lab
Gene Symbol Abtb1
Ensembl Gene ENSMUSG00000030083
Gene Nameankyrin repeat and BTB (POZ) domain containing 1
SynonymsBPOZ, EF1ABP
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88835914-88841984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88838258 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 297 (F297L)
Ref Sequence ENSEMBL: ENSMUSP00000032169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032169] [ENSMUST00000038409] [ENSMUST00000061262] [ENSMUST00000145944] [ENSMUST00000203137] [ENSMUST00000203272] [ENSMUST00000203864] [ENSMUST00000204327] [ENSMUST00000204458] [ENSMUST00000204932] [ENSMUST00000205082]
Predicted Effect probably damaging
Transcript: ENSMUST00000032169
AA Change: F297L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032169
Gene: ENSMUSG00000030083
AA Change: F297L

DomainStartEndE-ValueType
ANK 1 31 5.03e2 SMART
ANK 35 64 2.81e-4 SMART
BTB 115 212 7.8e-18 SMART
BTB 272 376 4.24e-19 SMART
low complexity region 412 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038409
SMART Domains Protein: ENSMUSP00000040417
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 9e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061262
SMART Domains Protein: ENSMUSP00000058985
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 5.4e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141401
Predicted Effect probably benign
Transcript: ENSMUST00000145944
SMART Domains Protein: ENSMUSP00000117954
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
coiled coil region 152 189 N/A INTRINSIC
low complexity region 196 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147542
Predicted Effect probably benign
Transcript: ENSMUST00000203120
Predicted Effect probably benign
Transcript: ENSMUST00000203137
Predicted Effect probably benign
Transcript: ENSMUST00000203272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203514
Predicted Effect probably benign
Transcript: ENSMUST00000203864
Predicted Effect probably benign
Transcript: ENSMUST00000204327
Predicted Effect probably benign
Transcript: ENSMUST00000204458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204560
Predicted Effect probably benign
Transcript: ENSMUST00000204932
Predicted Effect probably benign
Transcript: ENSMUST00000205082
Meta Mutation Damage Score 0.9066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Abtb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Abtb1 APN 6 88839449 missense probably damaging 0.98
IGL02264:Abtb1 APN 6 88836535 missense probably benign 0.00
IGL02376:Abtb1 APN 6 88838484 splice site probably benign
IGL02702:Abtb1 APN 6 88838138 missense probably benign
IGL03132:Abtb1 APN 6 88838959 missense probably benign 0.01
IGL03266:Abtb1 APN 6 88838934 missense probably damaging 0.97
PIT4243001:Abtb1 UTSW 6 88838726 missense probably benign 0.16
PIT4418001:Abtb1 UTSW 6 88839648 missense possibly damaging 0.78
R0331:Abtb1 UTSW 6 88840702 unclassified probably benign
R0763:Abtb1 UTSW 6 88838279 missense probably damaging 0.96
R1565:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1796:Abtb1 UTSW 6 88836619 missense possibly damaging 0.68
R1822:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R1824:Abtb1 UTSW 6 88836554 missense probably benign 0.03
R2225:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2227:Abtb1 UTSW 6 88836367 missense probably damaging 1.00
R2399:Abtb1 UTSW 6 88838738 missense possibly damaging 0.89
R4394:Abtb1 UTSW 6 88836584 missense probably damaging 0.96
R4625:Abtb1 UTSW 6 88836287 missense probably benign 0.00
R5552:Abtb1 UTSW 6 88836548 missense probably benign 0.04
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6035:Abtb1 UTSW 6 88841806 missense probably damaging 1.00
R6092:Abtb1 UTSW 6 88838451 missense probably benign
R6195:Abtb1 UTSW 6 88840736 missense probably benign 0.04
R7257:Abtb1 UTSW 6 88839452 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTAAGTGCAGGAATGACC -3'
(R):5'- CCGATATCTGCTTCCGAGTG -3'

Sequencing Primer
(F):5'- AGGGCTTGTTCACCACTG -3'
(R):5'- ATATCTGCTTCCGAGTGGCTGAC -3'
Posted On2016-07-22