Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Gm6614'

405644

Institutional Source

Beutler Lab

Gene Symbol

Gm6614

Ensembl Gene

ENSMUSG00000079263

Gene Name

predicted gene 6614

Synonyms

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141971845-142011414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141972332 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 606 (F606Y)

Ref Sequence

ENSEMBL: ENSMUSP00000137696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111832] [ENSMUST00000181628] [ENSMUST00000181791]

Predicted Effect

probably benign
Transcript: ENSMUST00000111832
AA Change: F606Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107463
Gene: ENSMUSG00000079263
AA Change: F606Y

Domain	Start	End	E-Value	Type
Pfam:OATP	1	577	2.5e-156	PFAM
Pfam:MFS_1	125	402	1e-23	PFAM
Pfam:Kazal_2	425	466	4.1e-9	PFAM
transmembrane domain	580	602	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000181628
AA Change: F626Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000137967
Gene: ENSMUSG00000079263
AA Change: F626Y

Domain	Start	End	E-Value	Type
Pfam:OATP	19	598	2.8e-187	PFAM
Pfam:MFS_1	145	422	8e-24	PFAM
Pfam:Kazal_2	445	486	1.1e-7	PFAM
transmembrane domain	600	622	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000181791
AA Change: F606Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000137696
Gene: ENSMUSG00000079263
AA Change: F606Y

Domain	Start	End	E-Value	Type
Pfam:OATP	1	578	2.3e-186	PFAM
Pfam:MFS_1	125	402	8.6e-24	PFAM
Pfam:Kazal_2	425	466	1.4e-7	PFAM
transmembrane domain	580	602	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Gm6614

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01354:Gm6614	APN	6	141990408	missense	probably benign	0.00
IGL01548:Gm6614	APN	6	141992512	missense	possibly damaging	0.82
IGL01552:Gm6614	APN	6	141987706	missense	possibly damaging	0.54
IGL02207:Gm6614	APN	6	141990432	missense	possibly damaging	0.80
IGL02227:Gm6614	APN	6	141993675	nonsense	probably null
IGL02547:Gm6614	APN	6	141990390	missense	probably damaging	0.99
IGL02678:Gm6614	APN	6	142008718	missense	probably damaging	1.00
IGL02695:Gm6614	APN	6	141987760	missense	probably damaging	1.00
IGL02851:Gm6614	APN	6	142003471	missense	probably damaging	1.00
IGL02881:Gm6614	APN	6	141972243	missense	probably benign	0.00
IGL02898:Gm6614	APN	6	141994297	missense	probably benign	0.01
IGL03036:Gm6614	APN	6	142008607	missense	possibly damaging	0.69
IGL03065:Gm6614	APN	6	141992502	missense	probably damaging	0.99
IGL03300:Gm6614	APN	6	141994806	missense	probably damaging	0.96
R0020:Gm6614	UTSW	6	141972350	missense	possibly damaging	0.93
R0020:Gm6614	UTSW	6	141972350	missense	possibly damaging	0.93
R0049:Gm6614	UTSW	6	141990421	missense	probably benign
R0049:Gm6614	UTSW	6	141990421	missense	probably benign
R0149:Gm6614	UTSW	6	141992477	missense	probably benign	0.01
R0270:Gm6614	UTSW	6	141972411	missense	possibly damaging	0.88
R0360:Gm6614	UTSW	6	141982327	splice site	probably benign
R0420:Gm6614	UTSW	6	141985477	splice site	probably benign
R0737:Gm6614	UTSW	6	142003428	missense	possibly damaging	0.79
R1344:Gm6614	UTSW	6	141985618	missense	probably damaging	1.00
R1464:Gm6614	UTSW	6	141992517	nonsense	probably null
R1464:Gm6614	UTSW	6	141992517	nonsense	probably null
R1590:Gm6614	UTSW	6	141980872	missense	probably benign	0.00
R1666:Gm6614	UTSW	6	141982049	splice site	probably null
R1669:Gm6614	UTSW	6	141987689	missense	probably benign	0.39
R1862:Gm6614	UTSW	6	142003423	missense	possibly damaging	0.95
R1882:Gm6614	UTSW	6	141993637	critical splice donor site	probably null
R2134:Gm6614	UTSW	6	141980978	missense	probably damaging	1.00
R2155:Gm6614	UTSW	6	141980944	missense	probably damaging	1.00
R2163:Gm6614	UTSW	6	141980938	missense	possibly damaging	0.55
R2227:Gm6614	UTSW	6	141992361	missense	possibly damaging	0.67
R2382:Gm6614	UTSW	6	141990480	missense	probably benign	0.00
R3773:Gm6614	UTSW	6	141972335	missense	probably benign	0.17
R4869:Gm6614	UTSW	6	141987766	missense	probably damaging	1.00
R4975:Gm6614	UTSW	6	141980873	missense	probably benign	0.30
R5061:Gm6614	UTSW	6	142008688	missense	probably benign	0.03
R5079:Gm6614	UTSW	6	141972347	missense	probably benign	0.00
R5691:Gm6614	UTSW	6	141994855	nonsense	probably null
R5874:Gm6614	UTSW	6	141972235	missense	probably benign	0.00
R5945:Gm6614	UTSW	6	141994282	missense	probably damaging	1.00
R6478:Gm6614	UTSW	6	141993642	missense	possibly damaging	0.93
R7305:Gm6614	UTSW	6	141992494	missense	probably damaging	1.00
R7325:Gm6614	UTSW	6	141989225	missense	probably damaging	0.98
R7427:Gm6614	UTSW	6	142003508	critical splice acceptor site	probably null
R7728:Gm6614	UTSW	6	141987710	nonsense	probably null
R7949:Gm6614	UTSW	6	141994265	missense	probably damaging	1.00
R8079:Gm6614	UTSW	6	141987734	missense	probably benign	0.00
R8095:Gm6614	UTSW	6	141987689	missense	probably benign	0.39
R8472:Gm6614	UTSW	6	142003389	missense	probably damaging	1.00
R8687:Gm6614	UTSW	6	141994265	missense	probably damaging	0.98
R8788:Gm6614	UTSW	6	141987844	missense	probably benign	0.00
RF021:Gm6614	UTSW	6	142008714	missense	probably damaging	0.98
Z1176:Gm6614	UTSW	6	141990348	missense	probably benign	0.01
Z1177:Gm6614	UTSW	6	141994202	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTTCATGGCCTTGCACAG -3'
(R):5'- CCAAGTGCTAGACATGCAGAG -3'

Sequencing Primer
(F):5'- CAGGGCAGTAGAAAACTCTTTAC -3'
(R):5'- AGACATGCAGAGTATGGTGTTCCC -3'

Posted On

2016-07-22