Incidental Mutation 'R5312:Zfp667'
ID405645
Institutional Source Beutler Lab
Gene Symbol Zfp667
Ensembl Gene ENSMUSG00000054893
Gene Namezinc finger protein 667
SynonymsA830025F02Rik
MMRRC Submission 042895-MU
Accession Numbers

Genbank: NM_001024928

Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location6286579-6307883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6305467 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 378 (I378T)
Ref Sequence ENSEMBL: ENSMUSP00000128658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086327] [ENSMUST00000108562] [ENSMUST00000153840] [ENSMUST00000170776]
Predicted Effect probably benign
Transcript: ENSMUST00000086327
AA Change: I378T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083507
Gene: ENSMUSG00000054893
AA Change: I378T

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108562
AA Change: I378T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104202
Gene: ENSMUSG00000054893
AA Change: I378T

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153840
Predicted Effect probably benign
Transcript: ENSMUST00000170776
AA Change: I378T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128658
Gene: ENSMUSG00000054893
AA Change: I378T

DomainStartEndE-ValueType
KRAB 14 74 4.77e-30 SMART
ZnF_C2H2 144 166 5.42e-2 SMART
ZnF_C2H2 172 194 3.11e-2 SMART
ZnF_C2H2 200 222 1.67e-2 SMART
ZnF_C2H2 253 275 2.57e-3 SMART
ZnF_C2H2 329 351 2.4e-3 SMART
ZnF_C2H2 357 379 3.16e-3 SMART
ZnF_C2H2 385 407 8.94e-3 SMART
ZnF_C2H2 414 436 5.06e-2 SMART
ZnF_C2H2 442 464 2.4e-3 SMART
ZnF_C2H2 470 492 5.29e-5 SMART
ZnF_C2H2 498 520 7.37e-4 SMART
ZnF_C2H2 526 548 1.38e-3 SMART
ZnF_C2H2 554 576 1.13e-4 SMART
ZnF_C2H2 582 604 1.38e-3 SMART
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Zfp667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Zfp667 APN 7 6305397 missense possibly damaging 0.53
IGL01325:Zfp667 APN 7 6290546 missense probably damaging 1.00
IGL01386:Zfp667 APN 7 6304870 missense probably benign 0.00
IGL01960:Zfp667 APN 7 6305337 missense probably benign 0.00
IGL03394:Zfp667 APN 7 6289439 critical splice donor site probably null
B5639:Zfp667 UTSW 7 6290545 missense probably damaging 1.00
R0458:Zfp667 UTSW 7 6304845 missense probably benign 0.40
R0845:Zfp667 UTSW 7 6306092 missense possibly damaging 0.85
R1768:Zfp667 UTSW 7 6305067 missense possibly damaging 0.53
R1953:Zfp667 UTSW 7 6305088 missense probably benign 0.04
R2023:Zfp667 UTSW 7 6305417 missense possibly damaging 0.85
R3159:Zfp667 UTSW 7 6306000 missense probably damaging 1.00
R4080:Zfp667 UTSW 7 6305106 missense possibly damaging 0.71
R4476:Zfp667 UTSW 7 6304599 missense possibly damaging 0.53
R4584:Zfp667 UTSW 7 6290625 missense possibly damaging 0.84
R4783:Zfp667 UTSW 7 6305685 missense possibly damaging 0.83
R5037:Zfp667 UTSW 7 6305950 missense possibly damaging 0.71
R5300:Zfp667 UTSW 7 6304636 missense probably benign
R5311:Zfp667 UTSW 7 6305716 missense probably benign 0.10
R5340:Zfp667 UTSW 7 6305253 missense possibly damaging 0.53
R6262:Zfp667 UTSW 7 6304974 missense probably benign 0.03
R7386:Zfp667 UTSW 7 6305950 missense possibly damaging 0.86
Z1177:Zfp667 UTSW 7 6304857 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTTGCCAGTCGGAAAACCC -3'
(R):5'- GCGATGAGCTCCGACTATAAG -3'

Sequencing Primer
(F):5'- GCCAGTCGGAAAACCCTTTTATGTG -3'
(R):5'- GCTGAGCGAAGGACTTCTTAC -3'
Posted On2016-07-22