Incidental Mutation 'R5312:9030624J02Rik'
List [record 1 of 51] next >> last >|
ID405648
Institutional Source Beutler Lab
Gene Symbol 9030624J02Rik
Ensembl Gene ENSMUSG00000030982
Gene NameRIKEN cDNA 9030624J02 gene
Synonyms
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5312 (G1)
Quality Score221
Status Validated
Chromosome7
Chromosomal Location118740226-118842966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118813576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 629 (I629T)
Ref Sequence ENSEMBL: ENSMUSP00000102162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033280] [ENSMUST00000059390] [ENSMUST00000106552] [ENSMUST00000106553]
Predicted Effect probably benign
Transcript: ENSMUST00000033280
AA Change: I483T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000059390
AA Change: I746T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051263
Gene: ENSMUSG00000030982
AA Change: I746T

DomainStartEndE-ValueType
low complexity region 71 100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106552
AA Change: I629T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102162
Gene: ENSMUSG00000030982
AA Change: I629T

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106553
AA Change: I695T

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102163
Gene: ENSMUSG00000030982
AA Change: I695T

DomainStartEndE-ValueType
low complexity region 47 76 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000149749
AA Change: I173T
SMART Domains Protein: ENSMUSP00000121323
Gene: ENSMUSG00000030982
AA Change: I173T

DomainStartEndE-ValueType
Pfam:Vps35 2 198 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176197
Meta Mutation Damage Score 0.3788 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in 9030624J02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:9030624J02Rik APN 7 118797047 critical splice donor site probably null
IGL00229:9030624J02Rik APN 7 118804191 splice site probably benign
IGL01066:9030624J02Rik APN 7 118773011 splice site probably null
IGL01433:9030624J02Rik APN 7 118774051 splice site probably null
IGL02381:9030624J02Rik APN 7 118775375 missense probably damaging 1.00
IGL02566:9030624J02Rik APN 7 118752832 missense probably benign 0.04
IGL03199:9030624J02Rik APN 7 118766388 missense probably benign 0.18
IGL03224:9030624J02Rik APN 7 118792553 unclassified probably benign
R0535:9030624J02Rik UTSW 7 118748181 missense possibly damaging 0.95
R1109:9030624J02Rik UTSW 7 118775329 missense probably damaging 0.97
R1378:9030624J02Rik UTSW 7 118794572 nonsense probably null
R1378:9030624J02Rik UTSW 7 118794573 missense probably damaging 1.00
R1412:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R1474:9030624J02Rik UTSW 7 118760213 missense probably damaging 1.00
R1586:9030624J02Rik UTSW 7 118809972 missense probably damaging 1.00
R1785:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1786:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R1921:9030624J02Rik UTSW 7 118833748 missense probably damaging 0.98
R1971:9030624J02Rik UTSW 7 118775334 missense probably damaging 1.00
R2038:9030624J02Rik UTSW 7 118811874 missense probably damaging 0.98
R2107:9030624J02Rik UTSW 7 118794539 unclassified probably benign
R2130:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2131:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2132:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2133:9030624J02Rik UTSW 7 118794575 missense probably damaging 1.00
R2405:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R2411:9030624J02Rik UTSW 7 118792595 missense probably damaging 1.00
R3910:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3911:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3912:9030624J02Rik UTSW 7 118746390 missense possibly damaging 0.86
R3971:9030624J02Rik UTSW 7 118833799 missense probably damaging 0.98
R4697:9030624J02Rik UTSW 7 118791448 missense probably damaging 1.00
R4964:9030624J02Rik UTSW 7 118780268 missense possibly damaging 0.84
R4980:9030624J02Rik UTSW 7 118807009 missense probably damaging 1.00
R5034:9030624J02Rik UTSW 7 118791388 missense probably damaging 0.99
R5309:9030624J02Rik UTSW 7 118813576 missense probably damaging 1.00
R5743:9030624J02Rik UTSW 7 118797011 missense possibly damaging 0.89
R6017:9030624J02Rik UTSW 7 118809921 missense probably damaging 1.00
R6089:9030624J02Rik UTSW 7 118746435 missense possibly damaging 0.76
R6320:9030624J02Rik UTSW 7 118753849 missense probably benign 0.08
R6415:9030624J02Rik UTSW 7 118792646 missense probably damaging 1.00
R6861:9030624J02Rik UTSW 7 118743675 missense probably damaging 1.00
R7034:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7036:9030624J02Rik UTSW 7 118773092 missense probably damaging 1.00
R7339:9030624J02Rik UTSW 7 118809971 missense probably damaging 0.99
R7456:9030624J02Rik UTSW 7 118804117 missense probably benign 0.01
R7493:9030624J02Rik UTSW 7 118794577 utr 5 prime probably null
R8064:9030624J02Rik UTSW 7 118753924 missense probably damaging 1.00
X0028:9030624J02Rik UTSW 7 118800452 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCATCAGAACTGGGATTGATGGG -3'
(R):5'- TTCAAGGCATCGCTCAGTAC -3'

Sequencing Primer
(F):5'- AACTGGGATTGATGGGGACTG -3'
(R):5'- TCGCTCAGTACATGCACG -3'
Posted On2016-07-22