Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Adgrg3'

405651

Institutional Source

Beutler Lab

Gene Symbol

Adgrg3

Ensembl Gene

ENSMUSG00000060470

Gene Name

adhesion G protein-coupled receptor G3

Synonyms

Gpr97, Pb99, A030001G24Rik

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95017692-95045250 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 95039864 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 388 (V388I)

Ref Sequence

ENSEMBL: ENSMUSP00000051079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051259]

Predicted Effect

probably benign
Transcript: ENSMUST00000051259
AA Change: V388I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470
AA Change: V388I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
GPS	209	256	3.45e-11	SMART
Pfam:7tm_2	260	509	5.1e-33	PFAM
low complexity region	520	531	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211974

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211994

Predicted Effect

probably benign
Transcript: ENSMUST00000212570

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

PHENOTYPE: Homozygous null mice display normal B and T cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Adgrg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Adgrg3	APN	8	95039593	missense	possibly damaging	0.90
IGL01724:Adgrg3	APN	8	95039425	missense	probably benign	0.04
IGL02111:Adgrg3	APN	8	95034999	missense	probably damaging	0.96
IGL02142:Adgrg3	APN	8	95039855	missense	probably damaging	1.00
IGL02577:Adgrg3	APN	8	95039927	missense	probably damaging	0.99
IGL02940:Adgrg3	APN	8	95033456	missense	possibly damaging	0.48
IGL03395:Adgrg3	APN	8	95035073	missense	probably damaging	1.00
R0111:Adgrg3	UTSW	8	95035110	splice site	probably benign
R0288:Adgrg3	UTSW	8	95039940	missense	possibly damaging	0.92
R0403:Adgrg3	UTSW	8	95036922	missense	probably benign	0.07
R1553:Adgrg3	UTSW	8	95040268	missense	possibly damaging	0.90
R1667:Adgrg3	UTSW	8	95033373	nonsense	probably null
R1686:Adgrg3	UTSW	8	95033369	missense	probably benign	0.02
R1872:Adgrg3	UTSW	8	95033442	missense	possibly damaging	0.87
R1882:Adgrg3	UTSW	8	95040315	missense	probably benign	0.03
R1924:Adgrg3	UTSW	8	95035934	missense	probably benign
R1998:Adgrg3	UTSW	8	95036668	missense	probably damaging	1.00
R2090:Adgrg3	UTSW	8	95039930	missense	possibly damaging	0.54
R2696:Adgrg3	UTSW	8	95021074	missense	probably benign	0.01
R3846:Adgrg3	UTSW	8	95040421	missense	probably benign	0.07
R4013:Adgrg3	UTSW	8	95035099	splice site	probably benign
R4405:Adgrg3	UTSW	8	95036908	missense	probably benign	0.15
R4622:Adgrg3	UTSW	8	95040525	missense	probably damaging	1.00
R4878:Adgrg3	UTSW	8	95035086	missense	possibly damaging	0.86
R5101:Adgrg3	UTSW	8	95036935	missense	probably benign	0.00
R5309:Adgrg3	UTSW	8	95039864	missense	probably benign	0.00
R5353:Adgrg3	UTSW	8	95035928	missense	probably damaging	0.99
R5820:Adgrg3	UTSW	8	95039593	missense	possibly damaging	0.90
R6240:Adgrg3	UTSW	8	95039916	missense	probably benign	0.23
R6272:Adgrg3	UTSW	8	95036261	missense	noncoding transcript
R7110:Adgrg3	UTSW	8	95034963	missense	possibly damaging	0.62
R7645:Adgrg3	UTSW	8	95034764	intron	probably benign
R8178:Adgrg3	UTSW	8	95035047	missense	probably damaging	0.98
R8397:Adgrg3	UTSW	8	95040513	missense	probably benign	0.01
R8730:Adgrg3	UTSW	8	95039928	missense	probably benign	0.09
X0017:Adgrg3	UTSW	8	95017770	start codon destroyed	probably null	0.53

Predicted Primers

PCR Primer
(F):5'- TACTTTGGACACTATTTCCTGAAGC -3'
(R):5'- TCCCAGCCTTGACATTGCTG -3'

Sequencing Primer
(F):5'- GGACACTATTTCCTGAAGCTGAGC -3'
(R):5'- GCCTTGACATTGCTGGCCTC -3'

Posted On

2016-07-22