Incidental Mutation 'R5312:Adgrg3'
List |< first << previous [record 5 of 51] next >> last >|
ID405651
Institutional Source Beutler Lab
Gene Symbol Adgrg3
Ensembl Gene ENSMUSG00000060470
Gene Nameadhesion G protein-coupled receptor G3
SynonymsGpr97, Pb99, A030001G24Rik
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95017692-95045250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95039864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 388 (V388I)
Ref Sequence ENSEMBL: ENSMUSP00000051079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051259]
Predicted Effect probably benign
Transcript: ENSMUST00000051259
AA Change: V388I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000051079
Gene: ENSMUSG00000060470
AA Change: V388I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 209 256 3.45e-11 SMART
Pfam:7tm_2 260 509 5.1e-33 PFAM
low complexity region 520 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211994
Predicted Effect probably benign
Transcript: ENSMUST00000212570
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous null mice display normal B and T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Adgrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Adgrg3 APN 8 95039593 missense possibly damaging 0.90
IGL01724:Adgrg3 APN 8 95039425 missense probably benign 0.04
IGL02111:Adgrg3 APN 8 95034999 missense probably damaging 0.96
IGL02142:Adgrg3 APN 8 95039855 missense probably damaging 1.00
IGL02577:Adgrg3 APN 8 95039927 missense probably damaging 0.99
IGL02940:Adgrg3 APN 8 95033456 missense possibly damaging 0.48
IGL03395:Adgrg3 APN 8 95035073 missense probably damaging 1.00
R0111:Adgrg3 UTSW 8 95035110 splice site probably benign
R0288:Adgrg3 UTSW 8 95039940 missense possibly damaging 0.92
R0403:Adgrg3 UTSW 8 95036922 missense probably benign 0.07
R1553:Adgrg3 UTSW 8 95040268 missense possibly damaging 0.90
R1667:Adgrg3 UTSW 8 95033373 nonsense probably null
R1686:Adgrg3 UTSW 8 95033369 missense probably benign 0.02
R1872:Adgrg3 UTSW 8 95033442 missense possibly damaging 0.87
R1882:Adgrg3 UTSW 8 95040315 missense probably benign 0.03
R1924:Adgrg3 UTSW 8 95035934 missense probably benign
R1998:Adgrg3 UTSW 8 95036668 missense probably damaging 1.00
R2090:Adgrg3 UTSW 8 95039930 missense possibly damaging 0.54
R2696:Adgrg3 UTSW 8 95021074 missense probably benign 0.01
R3846:Adgrg3 UTSW 8 95040421 missense probably benign 0.07
R4013:Adgrg3 UTSW 8 95035099 splice site probably benign
R4405:Adgrg3 UTSW 8 95036908 missense probably benign 0.15
R4622:Adgrg3 UTSW 8 95040525 missense probably damaging 1.00
R4878:Adgrg3 UTSW 8 95035086 missense possibly damaging 0.86
R5101:Adgrg3 UTSW 8 95036935 missense probably benign 0.00
R5309:Adgrg3 UTSW 8 95039864 missense probably benign 0.00
R5353:Adgrg3 UTSW 8 95035928 missense probably damaging 0.99
R5820:Adgrg3 UTSW 8 95039593 missense possibly damaging 0.90
R6240:Adgrg3 UTSW 8 95039916 missense probably benign 0.23
R6272:Adgrg3 UTSW 8 95036261 missense noncoding transcript
R7110:Adgrg3 UTSW 8 95034963 missense possibly damaging 0.62
R7645:Adgrg3 UTSW 8 95034764 intron probably benign
X0017:Adgrg3 UTSW 8 95017770 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- TACTTTGGACACTATTTCCTGAAGC -3'
(R):5'- TCCCAGCCTTGACATTGCTG -3'

Sequencing Primer
(F):5'- GGACACTATTTCCTGAAGCTGAGC -3'
(R):5'- GCCTTGACATTGCTGGCCTC -3'
Posted On2016-07-22