Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Lman1l'

405653

Institutional Source

Beutler Lab

Gene Symbol

Lman1l

Ensembl Gene

ENSMUSG00000056271

Gene Name

lectin, mannose-binding 1 like

Synonyms

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57607085-57620774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 57611077 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 343 (L343Q)

Ref Sequence

ENSEMBL: ENSMUSP00000091352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044937] [ENSMUST00000045068] [ENSMUST00000093832] [ENSMUST00000215487]

Predicted Effect

probably damaging
Transcript: ENSMUST00000044937
AA Change: L343Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000041631
Gene: ENSMUSG00000056271
AA Change: L343Q

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Lectin_leg-like	32	256	1.2e-53	PFAM
low complexity region	272	287	N/A	INTRINSIC
coiled coil region	316	337	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000045068

SMART Domains

Protein: ENSMUSP00000046748
Gene: ENSMUSG00000039714

Domain	Start	End	E-Value	Type
Pfam:Synaphin	1	139	5.7e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000093832
AA Change: L343Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091352
Gene: ENSMUSG00000056271
AA Change: L343Q

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Lectin_leg-like	32	256	2.7e-53	PFAM
low complexity region	272	287	N/A	INTRINSIC
coiled coil region	316	337	N/A	INTRINSIC
transmembrane domain	439	461	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000215487

Meta Mutation Damage Score

0.1088

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mannose-binding type 1 transmembrane protein that contains an N-terminal lectin-like carbohydrate recognition domain. The encoded protein is similar in structure to lectins found in leguminous plants. This lectin is thought to transport newly synthesized glycoproteins from the endoplasmic reticulum (ER) to the ER-Golgi intermediate compartment. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Lman1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01784:Lman1l	APN	9	57620564	missense	probably damaging	1.00
IGL03164:Lman1l	APN	9	57609995	missense	probably damaging	0.99
IGL03226:Lman1l	APN	9	57610007	missense	probably benign	0.43
PIT4283001:Lman1l	UTSW	9	57616076	missense	probably damaging	1.00
R0555:Lman1l	UTSW	9	57614101	missense	probably benign	0.15
R1168:Lman1l	UTSW	9	57608312	missense	probably benign	0.00
R1169:Lman1l	UTSW	9	57609995	missense	probably damaging	0.99
R1591:Lman1l	UTSW	9	57615802	missense	probably benign	0.30
R2289:Lman1l	UTSW	9	57613658	missense	possibly damaging	0.76
R3848:Lman1l	UTSW	9	57608317	missense	possibly damaging	0.48
R4685:Lman1l	UTSW	9	57609200	missense	probably damaging	0.98
R5170:Lman1l	UTSW	9	57615619	nonsense	probably null
R5309:Lman1l	UTSW	9	57611077	missense	probably damaging	0.98
R5639:Lman1l	UTSW	9	57611866	missense	probably benign	0.24
R5655:Lman1l	UTSW	9	57615975	missense	probably damaging	1.00
R5905:Lman1l	UTSW	9	57608263	missense	probably damaging	1.00
R6011:Lman1l	UTSW	9	57615755	missense	probably damaging	1.00
R6028:Lman1l	UTSW	9	57608263	missense	probably damaging	1.00
R6035:Lman1l	UTSW	9	57611747	critical splice donor site	probably null
R6035:Lman1l	UTSW	9	57611747	critical splice donor site	probably null
R6250:Lman1l	UTSW	9	57615624	missense	probably benign	0.00
R6488:Lman1l	UTSW	9	57620643	missense	possibly damaging	0.73
R6489:Lman1l	UTSW	9	57613726	splice site	probably null
R6720:Lman1l	UTSW	9	57614072	splice site	probably null
R7000:Lman1l	UTSW	9	57615948	missense	probably benign	0.27
R7139:Lman1l	UTSW	9	57615596	missense	probably benign	0.37
X0057:Lman1l	UTSW	9	57615957	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGTGGTTCCAGGGCAATTGC -3'
(R):5'- AGAAGAATCCTTGGCTCTTCCTG -3'

Sequencing Primer
(F):5'- CGTTAGGCAGTATCCTCTTACATAC -3'
(R):5'- GCTTCACCACAAAACAGGATTTTTC -3'

Posted On

2016-07-22