Incidental Mutation 'R5312:Ptprr'
ID405658
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Nameprotein tyrosine phosphatase, receptor type, R
SynonymsPTPBR7, PTP-SL, RPTPRR
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R5312 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location116018213-116274932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116188419 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 212 (S212T)
Ref Sequence ENSEMBL: ENSMUSP00000100907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
Predicted Effect probably benign
Transcript: ENSMUST00000063470
AA Change: S319T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: S319T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105271
AA Change: S212T

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: S212T

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128399
AA Change: S75T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: S75T

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148731
AA Change: S75T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: S75T

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155606
AA Change: S75T

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: S75T

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Meta Mutation Damage Score 0.0924 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116188317 missense probably benign 0.00
IGL01762:Ptprr APN 10 116236733 missense probably damaging 1.00
IGL02429:Ptprr APN 10 116273767 missense probably damaging 0.99
IGL03396:Ptprr APN 10 116188330 missense probably damaging 1.00
R0268:Ptprr UTSW 10 116252963 missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116251158 missense probably damaging 0.96
R1388:Ptprr UTSW 10 116273752 missense probably benign 0.14
R1438:Ptprr UTSW 10 116256204 missense probably damaging 0.98
R1533:Ptprr UTSW 10 116188208 nonsense probably null
R1654:Ptprr UTSW 10 116188363 missense probably benign 0.43
R1793:Ptprr UTSW 10 116252922 missense probably damaging 1.00
R4081:Ptprr UTSW 10 116236710 missense probably benign 0.01
R4193:Ptprr UTSW 10 116252864 missense probably damaging 1.00
R4254:Ptprr UTSW 10 116162443 splice site probably null
R4496:Ptprr UTSW 10 116229502 missense possibly damaging 0.91
R4799:Ptprr UTSW 10 116048218 missense probably benign 0.00
R5209:Ptprr UTSW 10 116162609 missense probably damaging 0.99
R5410:Ptprr UTSW 10 116188330 missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116251149 missense probably damaging 0.96
R5717:Ptprr UTSW 10 116048113 missense probably benign 0.11
R6039:Ptprr UTSW 10 116236763 splice site probably null
R6039:Ptprr UTSW 10 116236763 splice site probably null
R7013:Ptprr UTSW 10 116236754 missense probably damaging 1.00
R7401:Ptprr UTSW 10 116048236 missense probably benign
R7527:Ptprr UTSW 10 116251199 missense probably benign 0.08
R7644:Ptprr UTSW 10 116048228 missense probably benign 0.00
R7651:Ptprr UTSW 10 116251179 missense probably benign 0.01
R7708:Ptprr UTSW 10 116162597 missense probably benign 0.31
R7731:Ptprr UTSW 10 116237295 missense probably damaging 1.00
R8026:Ptprr UTSW 10 116048170 missense probably damaging 1.00
R8261:Ptprr UTSW 10 116237264 missense possibly damaging 0.95
R8358:Ptprr UTSW 10 116048275 missense probably benign 0.25
R8387:Ptprr UTSW 10 116251125 missense probably damaging 1.00
R8894:Ptprr UTSW 10 116048345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAAGGCTTCAGCTTTCCTTAAGAC -3'
(R):5'- AGAAACCTACTTCCTGGGGC -3'

Sequencing Primer
(F):5'- TCAGCTTTCCTTAAGACAAGATAAAG -3'
(R):5'- CCATCTCATGGTGAATGGTTCTGC -3'
Posted On2016-07-22