Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Ppp4r4'

405662

Institutional Source

Beutler Lab

Gene Symbol

Ppp4r4

Ensembl Gene

ENSMUSG00000021209

Gene Name

protein phosphatase 4, regulatory subunit 4

Synonyms

8430415E04Rik

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.186) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103532283-103613831 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 103606888 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190151]

Predicted Effect

probably null
Transcript: ENSMUST00000021631

SMART Domains

Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	55	577	6e-27	SMART
PDB:3FGA\|A	178	666	8e-6	PDB
coiled coil region	690	726	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187155

SMART Domains

Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209

Domain	Start	End	E-Value	Type
Pfam:HEAT	145	175	2.8e-3	PFAM
low complexity region	484	495	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000187155

SMART Domains

Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209

Domain	Start	End	E-Value	Type
Pfam:HEAT	145	175	2.8e-3	PFAM
low complexity region	484	495	N/A	INTRINSIC
coiled coil region	581	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189871

SMART Domains

Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	95	577	7e-26	SMART
PDB:1B3U\|B	178	666	2e-6	PDB
coiled coil region	690	726	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190151

SMART Domains

Protein: ENSMUSP00000139815
Gene: ENSMUSG00000021209

Domain	Start	End	E-Value	Type
low complexity region	99	114	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Ppp4r4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:Ppp4r4	APN	12	103579076	missense	probably benign
IGL01388:Ppp4r4	APN	12	103576849	missense	probably damaging	1.00
IGL01662:Ppp4r4	APN	12	103602966	missense	possibly damaging	0.55
IGL01768:Ppp4r4	APN	12	103581405	missense	probably benign	0.12
IGL01894:Ppp4r4	APN	12	103593138	missense	probably damaging	1.00
IGL01921:Ppp4r4	APN	12	103576310	start codon destroyed	probably null	0.01
IGL01960:Ppp4r4	APN	12	103581494	splice site	probably benign
IGL02084:Ppp4r4	APN	12	103600398	missense	possibly damaging	0.93
IGL02287:Ppp4r4	APN	12	103587488	missense	probably benign	0.01
IGL02315:Ppp4r4	APN	12	103600361	splice site	probably benign
IGL03137:Ppp4r4	APN	12	103581384	missense	probably damaging	1.00
IGL03170:Ppp4r4	APN	12	103590774	intron	probably benign
cataract	UTSW	12	103612815	nonsense	probably null
downfall	UTSW	12	103593098	missense	probably benign	0.00
R0114:Ppp4r4	UTSW	12	103576374	missense	probably benign	0.00
R0390:Ppp4r4	UTSW	12	103601360	splice site	probably benign
R0403:Ppp4r4	UTSW	12	103584102	missense	probably benign
R0548:Ppp4r4	UTSW	12	103612815	nonsense	probably null
R0601:Ppp4r4	UTSW	12	103600520	splice site	probably benign
R0894:Ppp4r4	UTSW	12	103600495	missense	probably damaging	0.99
R1127:Ppp4r4	UTSW	12	103579068	missense	probably damaging	1.00
R1177:Ppp4r4	UTSW	12	103576323	missense	possibly damaging	0.82
R1378:Ppp4r4	UTSW	12	103581492	splice site	probably benign
R1442:Ppp4r4	UTSW	12	103598245	missense	probably damaging	0.97
R1497:Ppp4r4	UTSW	12	103606945	missense	probably benign	0.07
R1651:Ppp4r4	UTSW	12	103584072	missense	probably benign	0.01
R1797:Ppp4r4	UTSW	12	103598151	missense	possibly damaging	0.95
R1880:Ppp4r4	UTSW	12	103605035	missense	possibly damaging	0.62
R2008:Ppp4r4	UTSW	12	103585757	missense	probably damaging	1.00
R2038:Ppp4r4	UTSW	12	103576280	critical splice acceptor site	probably null
R2404:Ppp4r4	UTSW	12	103581490	splice site	probably null
R2696:Ppp4r4	UTSW	12	103581394	missense	possibly damaging	0.77
R2849:Ppp4r4	UTSW	12	103606933	missense	probably benign	0.00
R2965:Ppp4r4	UTSW	12	103612821	missense	probably damaging	1.00
R3030:Ppp4r4	UTSW	12	103606956	missense	probably benign
R3805:Ppp4r4	UTSW	12	103600366	missense	probably damaging	0.99
R3862:Ppp4r4	UTSW	12	103596421	nonsense	probably null
R4194:Ppp4r4	UTSW	12	103558445	missense	probably damaging	1.00
R4320:Ppp4r4	UTSW	12	103598243	missense	probably damaging	1.00
R4558:Ppp4r4	UTSW	12	103606933	missense	probably benign	0.00
R4783:Ppp4r4	UTSW	12	103590858	critical splice donor site	probably null
R4866:Ppp4r4	UTSW	12	103600447	missense	possibly damaging	0.92
R4903:Ppp4r4	UTSW	12	103590771	splice site	probably null
R5309:Ppp4r4	UTSW	12	103606888	splice site	probably null
R5381:Ppp4r4	UTSW	12	103593098	missense	probably benign	0.00
R5383:Ppp4r4	UTSW	12	103584168	missense	probably benign	0.14
R5447:Ppp4r4	UTSW	12	103584151	missense	possibly damaging	0.67
R5942:Ppp4r4	UTSW	12	103587447	missense	possibly damaging	0.92
R6339:Ppp4r4	UTSW	12	103604969	nonsense	probably null
R6386:Ppp4r4	UTSW	12	103593105	missense	probably damaging	1.00
R6712:Ppp4r4	UTSW	12	103596443	missense	probably damaging	1.00
R6755:Ppp4r4	UTSW	12	103585737	missense	probably damaging	1.00
R6868:Ppp4r4	UTSW	12	103590852	missense	probably damaging	1.00
R6879:Ppp4r4	UTSW	12	103551920	splice site	probably null
R7355:Ppp4r4	UTSW	12	103604582	nonsense	probably null
R7397:Ppp4r4	UTSW	12	103612806	critical splice acceptor site	probably null
R7447:Ppp4r4	UTSW	12	103585726	missense	possibly damaging	0.46
R7576:Ppp4r4	UTSW	12	103596449	missense	probably damaging	0.97
R7653:Ppp4r4	UTSW	12	103584145	missense	probably damaging	0.98
R7683:Ppp4r4	UTSW	12	103587105	nonsense	probably null
R7748:Ppp4r4	UTSW	12	103605061	critical splice donor site	probably null
R7831:Ppp4r4	UTSW	12	103590821	missense	possibly damaging	0.76
R7833:Ppp4r4	UTSW	12	103598148	missense	probably benign	0.03
R8238:Ppp4r4	UTSW	12	103590807	missense	probably benign	0.20
R8559:Ppp4r4	UTSW	12	103593161	missense	probably benign	0.04
R8674:Ppp4r4	UTSW	12	103596461	missense	probably damaging	0.97
R8799:Ppp4r4	UTSW	12	103601364	missense	possibly damaging	0.60
R8847:Ppp4r4	UTSW	12	103596488	missense	probably damaging	1.00
X0025:Ppp4r4	UTSW	12	103600480	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTGCATTTTGAAGCATG -3'
(R):5'- CCCAGTCACAGGAATAGTTTAATTG -3'

Sequencing Primer
(F):5'- GGTGCATTTTGAAGCATGAATGTAAG -3'
(R):5'- GCTTAAAGACTTGATGAAGACAAATG -3'

Posted On

2016-07-22