Incidental Mutation 'R5312:Washc5'
ID405667
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene NameWASH complex subunit 5
SynonymsE430025E21Rik, strumpellin
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5312 (G1)
Quality Score222
Status Validated
Chromosome15
Chromosomal Location59331997-59374167 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 59345528 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
Predicted Effect probably null
Transcript: ENSMUST00000022976
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350

DomainStartEndE-ValueType
Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227725
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Kbtbd11 A G 8: 15,028,589 D396G possibly damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59337276 missense probably damaging 0.99
IGL01096:Washc5 APN 15 59350211 splice site probably benign
IGL01305:Washc5 APN 15 59355839 nonsense probably null
IGL01707:Washc5 APN 15 59342015 missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59342109 splice site probably null
IGL02056:Washc5 APN 15 59350336 missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59369211 missense probably benign
IGL02430:Washc5 APN 15 59366291 missense probably damaging 1.00
IGL02450:Washc5 APN 15 59332317 nonsense probably null
IGL03238:Washc5 APN 15 59346842 missense probably damaging 1.00
IGL03351:Washc5 APN 15 59363350 splice site probably benign
ANU22:Washc5 UTSW 15 59355839 nonsense probably null
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59352530 missense probably benign 0.01
R0265:Washc5 UTSW 15 59338960 missense probably benign 0.43
R0315:Washc5 UTSW 15 59341976 missense probably damaging 1.00
R0545:Washc5 UTSW 15 59342093 missense possibly damaging 0.50
R0611:Washc5 UTSW 15 59341158 missense probably damaging 0.99
R0636:Washc5 UTSW 15 59359409 missense probably benign 0.01
R1006:Washc5 UTSW 15 59369186 missense probably benign 0.21
R1006:Washc5 UTSW 15 59369187 missense probably benign 0.06
R1237:Washc5 UTSW 15 59338908 splice site probably benign
R1835:Washc5 UTSW 15 59359340 missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R2005:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59350408 missense probably damaging 1.00
R2134:Washc5 UTSW 15 59369234 missense probably damaging 1.00
R2139:Washc5 UTSW 15 59350142 missense probably damaging 1.00
R2177:Washc5 UTSW 15 59363269 nonsense probably null
R2975:Washc5 UTSW 15 59345358 missense probably damaging 1.00
R4088:Washc5 UTSW 15 59339862 missense probably damaging 1.00
R4824:Washc5 UTSW 15 59333636 nonsense probably null
R4843:Washc5 UTSW 15 59350371 missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59344080 missense probably damaging 1.00
R4996:Washc5 UTSW 15 59333635 missense probably benign
R5103:Washc5 UTSW 15 59350169 missense probably damaging 1.00
R5591:Washc5 UTSW 15 59369163 missense probably damaging 1.00
R6073:Washc5 UTSW 15 59335170 missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59335110 missense probably damaging 1.00
R6156:Washc5 UTSW 15 59345399 missense probably damaging 1.00
R6292:Washc5 UTSW 15 59355934 missense probably damaging 1.00
R6297:Washc5 UTSW 15 59344046 missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59337195 missense probably benign 0.14
R6659:Washc5 UTSW 15 59340890 critical splice donor site probably null
R6880:Washc5 UTSW 15 59350172 missense probably benign 0.00
R7146:Washc5 UTSW 15 59352501 nonsense probably null
R7330:Washc5 UTSW 15 59333667 missense probably benign 0.02
R7430:Washc5 UTSW 15 59369913 nonsense probably null
R7490:Washc5 UTSW 15 59337204 missense probably benign 0.18
R7532:Washc5 UTSW 15 59367411 missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59366192 missense probably damaging 0.97
R7803:Washc5 UTSW 15 59368459 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGGGACTCAACCATTTTCAGTAG -3'
(R):5'- GTAGAGTGTCTAACAGCACGAC -3'

Sequencing Primer
(F):5'- CAAAACTTTCTTGTTGGTATTGCTG -3'
(R):5'- ACGACCTGCCAGTGAACCTG -3'
Posted On2016-07-22