Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Washc5'

405667

Institutional Source

Beutler Lab

Gene Symbol

Washc5

Ensembl Gene

ENSMUSG00000022350

Gene Name

WASH complex subunit 5

Synonyms

E430025E21Rik, strumpellin

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.893) question?

Stock #

R5312 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

59331997-59374167 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 59345528 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]

Predicted Effect

probably null
Transcript: ENSMUST00000022976

SMART Domains

Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350

Domain	Start	End	E-Value	Type
Pfam:Strumpellin	23	1103	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000227725

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Cntnap5c	A	T	17: 58,359,254	E1093V	probably benign	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Washc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Washc5	APN	15	59337276	missense	probably damaging	0.99
IGL01096:Washc5	APN	15	59350211	splice site	probably benign
IGL01305:Washc5	APN	15	59355839	nonsense	probably null
IGL01707:Washc5	APN	15	59342015	missense	possibly damaging	0.89
IGL01921:Washc5	APN	15	59342109	splice site	probably null
IGL02056:Washc5	APN	15	59350336	missense	possibly damaging	0.63
IGL02145:Washc5	APN	15	59369211	missense	probably benign
IGL02430:Washc5	APN	15	59366291	missense	probably damaging	1.00
IGL02450:Washc5	APN	15	59332317	nonsense	probably null
IGL03238:Washc5	APN	15	59346842	missense	probably damaging	1.00
IGL03351:Washc5	APN	15	59363350	splice site	probably benign
ANU22:Washc5	UTSW	15	59355839	nonsense	probably null
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0004:Washc5	UTSW	15	59367467	missense	probably damaging	1.00
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0100:Washc5	UTSW	15	59344098	missense	possibly damaging	0.83
R0179:Washc5	UTSW	15	59352530	missense	probably benign	0.01
R0265:Washc5	UTSW	15	59338960	missense	probably benign	0.43
R0315:Washc5	UTSW	15	59341976	missense	probably damaging	1.00
R0545:Washc5	UTSW	15	59342093	missense	possibly damaging	0.50
R0611:Washc5	UTSW	15	59341158	missense	probably damaging	0.99
R0636:Washc5	UTSW	15	59359409	missense	probably benign	0.01
R1006:Washc5	UTSW	15	59369186	missense	probably benign	0.21
R1006:Washc5	UTSW	15	59369187	missense	probably benign	0.06
R1237:Washc5	UTSW	15	59338908	splice site	probably benign
R1835:Washc5	UTSW	15	59359340	missense	possibly damaging	0.86
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R1888:Washc5	UTSW	15	59359325	missense	probably damaging	0.99
R2005:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2006:Washc5	UTSW	15	59341155	missense	possibly damaging	0.89
R2060:Washc5	UTSW	15	59350408	missense	probably damaging	1.00
R2134:Washc5	UTSW	15	59369234	missense	probably damaging	1.00
R2139:Washc5	UTSW	15	59350142	missense	probably damaging	1.00
R2177:Washc5	UTSW	15	59363269	nonsense	probably null
R2975:Washc5	UTSW	15	59345358	missense	probably damaging	1.00
R4088:Washc5	UTSW	15	59339862	missense	probably damaging	1.00
R4824:Washc5	UTSW	15	59333636	nonsense	probably null
R4843:Washc5	UTSW	15	59350371	missense	possibly damaging	0.95
R4991:Washc5	UTSW	15	59344080	missense	probably damaging	1.00
R4996:Washc5	UTSW	15	59333635	missense	probably benign
R5103:Washc5	UTSW	15	59350169	missense	probably damaging	1.00
R5591:Washc5	UTSW	15	59369163	missense	probably damaging	1.00
R6073:Washc5	UTSW	15	59335170	missense	possibly damaging	0.90
R6123:Washc5	UTSW	15	59335110	missense	probably damaging	1.00
R6156:Washc5	UTSW	15	59345399	missense	probably damaging	1.00
R6292:Washc5	UTSW	15	59355934	missense	probably damaging	1.00
R6297:Washc5	UTSW	15	59344046	missense	possibly damaging	0.61
R6374:Washc5	UTSW	15	59337195	missense	probably benign	0.14
R6659:Washc5	UTSW	15	59340890	critical splice donor site	probably null
R6880:Washc5	UTSW	15	59350172	missense	probably benign	0.00
R7146:Washc5	UTSW	15	59352501	nonsense	probably null
R7330:Washc5	UTSW	15	59333667	missense	probably benign	0.02
R7430:Washc5	UTSW	15	59369913	nonsense	probably null
R7490:Washc5	UTSW	15	59337204	missense	probably benign	0.18
R7532:Washc5	UTSW	15	59367411	missense	possibly damaging	0.46
R7560:Washc5	UTSW	15	59366192	missense	probably damaging	0.97
R7803:Washc5	UTSW	15	59368459	missense	probably damaging	0.98
R8841:Washc5	UTSW	15	59335122	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGGACTCAACCATTTTCAGTAG -3'
(R):5'- GTAGAGTGTCTAACAGCACGAC -3'

Sequencing Primer
(F):5'- CAAAACTTTCTTGTTGGTATTGCTG -3'
(R):5'- ACGACCTGCCAGTGAACCTG -3'

Posted On

2016-07-22