Mutagenetix > Incidental Mutations

Incidental Mutation 'R0497:Spdef'

40567

Institutional Source

Beutler Lab

Gene Symbol

Spdef

Ensembl Gene

ENSMUSG00000024215

Gene Name

SAM pointed domain containing ets transcription factor

Synonyms

Pse, PDEF

MMRRC Submission

038693-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.603) question?

Stock #

R0497 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

27714352-27728951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 27718058 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 190 (D190E)

Ref Sequence

ENSEMBL: ENSMUSP00000127056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025054] [ENSMUST00000114870] [ENSMUST00000138970] [ENSMUST00000167489]

Predicted Effect

probably benign
Transcript: ENSMUST00000025054
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000025054
Gene: ENSMUSG00000024215
AA Change: D190E

Domain	Start	End	E-Value	Type
SAM_PNT	121	203	4.68e-33	SMART
ETS	238	325	4.06e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114870
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000110520
Gene: ENSMUSG00000024215
AA Change: D190E

Domain	Start	End	E-Value	Type
SAM_PNT	121	203	4.68e-33	SMART
ETS	238	325	4.06e-45	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127622

Predicted Effect

probably benign
Transcript: ENSMUST00000138970

Predicted Effect

probably benign
Transcript: ENSMUST00000167489
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000127056
Gene: ENSMUSG00000024215
AA Change: D190E

Domain	Start	End	E-Value	Type
SAM_PNT	121	203	4.68e-33	SMART
ETS	238	325	4.06e-45	SMART

Meta Mutation Damage Score

0.2505

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele have reduced numbers of intestinal and respiratory mucosa goblet cells. Increased inflammation of the gastric antrum has also been seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,147,465	C1158S	probably damaging	Het
Aatk	A	C	11: 120,018,780	V110G	probably damaging	Het
Adcy6	A	C	15: 98,597,725		probably null	Het
Adm	A	G	7: 110,629,121	T170A	probably benign	Het
Afap1l2	G	T	19: 56,930,209	N171K	probably benign	Het
Aph1b	G	T	9: 66,790,618	S112*	probably null	Het
Arhgap23	A	G	11: 97,452,163	S424G	probably damaging	Het
Asah2	T	A	19: 32,054,631	N46I	probably benign	Het
Braf	G	A	6: 39,640,549		probably benign	Het
Brd2	C	T	17: 34,114,360	R47Q	probably damaging	Het
C2cd5	A	G	6: 143,012,093	V972A	probably benign	Het
Car9	T	A	4: 43,511,881	L300H	probably damaging	Het
Chmp3	T	C	6: 71,552,411	S20P	probably damaging	Het
Chp1	A	G	2: 119,571,782	N79S	possibly damaging	Het
Cnot2	A	T	10: 116,498,355	I335N	probably damaging	Het
Cntnap4	T	C	8: 112,570,151	V6A	probably benign	Het
Ctcf	T	A	8: 105,675,040		probably benign	Het
Dennd1b	A	G	1: 139,039,986		probably benign	Het
Dirc2	A	T	16: 35,735,604	V162D	probably benign	Het
Dnmbp	A	G	19: 43,856,640		probably benign	Het
Eef2	T	C	10: 81,181,586	F782L	probably benign	Het
Eogt	T	A	6: 97,135,233	Y153F	probably benign	Het
Fam81a	G	T	9: 70,096,119	Q237K	possibly damaging	Het
Fat2	T	A	11: 55,283,402	T2162S	probably benign	Het
Gas6	T	C	8: 13,470,387	I434V	possibly damaging	Het
Gm42417	A	T	1: 36,532,167	L77Q	probably damaging	Het
Grik3	A	T	4: 125,623,510	N49Y	possibly damaging	Het
Gucy2e	A	T	11: 69,224,159	V974E	probably damaging	Het
Helz2	A	G	2: 181,229,656	V2721A	probably damaging	Het
Klhl6	GT	G	16: 19,956,966		probably null	Het
Krt73	A	G	15: 101,802,230	L23P	probably damaging	Het
L3mbtl3	T	C	10: 26,282,874		probably benign	Het
Lrrc15	A	T	16: 30,272,892	V543E	probably damaging	Het
Med13	G	A	11: 86,276,983		probably benign	Het
Med25	T	C	7: 44,892,100	D60G	probably damaging	Het
Mgam	T	A	6: 40,664,892	Y560N	probably damaging	Het
Mlkl	A	G	8: 111,327,873	Y211H	probably damaging	Het
Msl2	A	G	9: 101,101,294	N289S	probably benign	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1281	A	G	2: 111,328,830	D137G	probably benign	Het
Omt2b	T	C	9: 78,328,231		probably benign	Het
Pald1	A	G	10: 61,341,315	L652P	probably damaging	Het
Pard3b	T	A	1: 62,440,008		probably null	Het
Prdm15	G	A	16: 97,794,334	T1098I	possibly damaging	Het
Rock2	A	G	12: 16,954,953	T436A	probably benign	Het
Sema4c	A	T	1: 36,549,608	D812E	probably benign	Het
Sla	A	T	15: 66,792,249	I91K	probably benign	Het
Slc22a16	T	G	10: 40,584,967	M255R	probably damaging	Het
Smg8	C	T	11: 87,086,084	D224N	possibly damaging	Het
Taok1	A	G	11: 77,573,804	I152T	probably damaging	Het
Tmem220	A	G	11: 67,025,922	D36G	probably damaging	Het
Tmem235	A	C	11: 117,864,351	I210L	probably benign	Het
Tmem266	C	T	9: 55,380,884		probably null	Het
Tmprss12	A	G	15: 100,281,039		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Usp38	T	A	8: 80,984,424		probably benign	Het
Usp44	C	T	10: 93,846,806	P373S	possibly damaging	Het
Vmn1r209	G	T	13: 22,805,948	Q191K	probably damaging	Het
Vmn1r70	T	C	7: 10,634,026	I147T	probably benign	Het
Vmn2r107	T	A	17: 20,375,132	I649N	probably damaging	Het
Vmn2r12	A	T	5: 109,091,889	Y269*	probably null	Het
Zan	C	T	5: 137,412,676		probably benign	Het
Zfp616	G	T	11: 74,083,480	V192L	probably benign	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zgrf1	T	C	3: 127,584,650		probably benign	Het
Zhx3	A	T	2: 160,779,994	L751*	probably null	Het
Znfx1	T	A	2: 167,055,411	Q531L	probably benign	Het

Other mutations in Spdef

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0211:Spdef	UTSW	17	27714920	missense	probably damaging	1.00
R0211:Spdef	UTSW	17	27714920	missense	probably damaging	1.00
R0972:Spdef	UTSW	17	27715023	missense	probably damaging	1.00
R2255:Spdef	UTSW	17	27720295	missense	probably benign	0.01
R4930:Spdef	UTSW	17	27718162	missense	probably damaging	1.00
R7151:Spdef	UTSW	17	27720160	missense	possibly damaging	0.92
R7339:Spdef	UTSW	17	27720245	missense	probably benign
R7392:Spdef	UTSW	17	27717288	missense	probably benign	0.06
V8831:Spdef	UTSW	17	27718077	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCACCTGAGTGCATCTGTCTCC -3'
(R):5'- TGTGCCTTCATGGGCTTCTCAAG -3'

Sequencing Primer
(F):5'- TTCATCTCAGACCTCTAAGGGAAAG -3'
(R):5'- CAGCAGCCTTGAACTAGTGTG -3'

Posted On

2013-05-23