Incidental Mutation 'R0497:Spdef'
ID40567
Institutional Source Beutler Lab
Gene Symbol Spdef
Ensembl Gene ENSMUSG00000024215
Gene NameSAM pointed domain containing ets transcription factor
SynonymsPse, PDEF
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R0497 (G1)
Quality Score218
Status Validated
Chromosome17
Chromosomal Location27714352-27728951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27718058 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 190 (D190E)
Ref Sequence ENSEMBL: ENSMUSP00000127056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025054] [ENSMUST00000114870] [ENSMUST00000138970] [ENSMUST00000167489]
Predicted Effect probably benign
Transcript: ENSMUST00000025054
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025054
Gene: ENSMUSG00000024215
AA Change: D190E

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114870
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000110520
Gene: ENSMUSG00000024215
AA Change: D190E

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127622
Predicted Effect probably benign
Transcript: ENSMUST00000138970
Predicted Effect probably benign
Transcript: ENSMUST00000167489
AA Change: D190E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127056
Gene: ENSMUSG00000024215
AA Change: D190E

DomainStartEndE-ValueType
SAM_PNT 121 203 4.68e-33 SMART
ETS 238 325 4.06e-45 SMART
Meta Mutation Damage Score 0.2505 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ETS family of transcription factors. It is highly expressed in the prostate epithelial cells, and functions as an androgen-independent transactivator of prostate-specific antigen (PSA) promoter. Higher expression of this protein has also been reported in brain, breast, lung and ovarian tumors, compared to the corresponding normal tissues, and it shows better tumor-association than other cancer-associated molecules, making it a more suitable target for developing specific cancer therapies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele have reduced numbers of intestinal and respiratory mucosa goblet cells. Increased inflammation of the gastric antrum has also been seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
L3mbtl3 T C 10: 26,282,874 probably benign Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in Spdef
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0211:Spdef UTSW 17 27714920 missense probably damaging 1.00
R0972:Spdef UTSW 17 27715023 missense probably damaging 1.00
R2255:Spdef UTSW 17 27720295 missense probably benign 0.01
R4930:Spdef UTSW 17 27718162 missense probably damaging 1.00
R7151:Spdef UTSW 17 27720160 missense possibly damaging 0.92
R7339:Spdef UTSW 17 27720245 missense probably benign
R7392:Spdef UTSW 17 27717288 missense probably benign 0.06
V8831:Spdef UTSW 17 27718077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCACCTGAGTGCATCTGTCTCC -3'
(R):5'- TGTGCCTTCATGGGCTTCTCAAG -3'

Sequencing Primer
(F):5'- TTCATCTCAGACCTCTAAGGGAAAG -3'
(R):5'- CAGCAGCCTTGAACTAGTGTG -3'
Posted On2013-05-23