Mutagenetix > Incidental Mutations

Incidental Mutation 'R5312:Cntnap5c'

405673

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5c

Ensembl Gene

ENSMUSG00000038048

Gene Name

contactin associated protein-like 5C

Synonyms

MMRRC Submission

042895-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5312 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57769570-58410355 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58359254 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 1093 (E1093V)

Ref Sequence

ENSEMBL: ENSMUSP00000075416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076038]

Predicted Effect

probably benign
Transcript: ENSMUST00000076038
AA Change: E1093V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: E1093V

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	29	174	1.26e-10	SMART
LamG	201	338	1.57e-29	SMART
LamG	387	521	3e-26	SMART
EGF	549	583	1.88e-1	SMART
Blast:FBG	586	769	8e-83	BLAST
LamG	811	938	4.37e-28	SMART
EGF	959	995	6.55e-1	SMART
LamG	1036	1172	2.08e-11	SMART
transmembrane domain	1240	1262	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	C	7: 118,813,576	I629T	probably damaging	Het
Abca15	T	C	7: 120,345,369	V409A	probably damaging	Het
Abtb1	A	G	6: 88,838,258	F297L	probably damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adgrg3	G	A	8: 95,039,864	V388I	probably benign	Het
Adnp	T	C	2: 168,184,188	T396A	probably benign	Het
Ank2	T	C	3: 126,959,768	Q288R	probably damaging	Het
Bdp1	T	C	13: 100,097,601		probably null	Het
Ccdc173	T	C	2: 69,787,258	T60A	possibly damaging	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Dmrta1	A	C	4: 89,692,047	N415H	probably damaging	Het
Dnaaf5	T	A	5: 139,152,862	V266E	probably damaging	Het
Dot1l	A	G	10: 80,784,637	Q511R	possibly damaging	Het
Ehmt1	A	G	2: 24,884,195	V201A	probably damaging	Het
Fancg	A	G	4: 43,003,019	F613L	probably benign	Het
Fbxo10	A	T	4: 45,042,036	I731N	possibly damaging	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Gm5155	T	G	7: 17,909,142	H492Q	probably damaging	Het
Gm6614	A	T	6: 141,972,332	F606Y	probably benign	Het
Ighv1-74	A	G	12: 115,802,881	S39P	probably damaging	Het
Kbtbd11	A	G	8: 15,028,589	D396G	possibly damaging	Het
Klc1	A	G	12: 111,795,621	K575R	possibly damaging	Het
Lman1l	A	T	9: 57,611,077	L343Q	probably damaging	Het
Mki67	A	T	7: 135,700,830	V825E	probably damaging	Het
Mus81	T	C	19: 5,483,494	K489R	possibly damaging	Het
Myog	A	G	1: 134,290,326	K91E	probably damaging	Het
Nfil3	A	T	13: 52,967,620	V416E	probably damaging	Het
Nup160	G	T	2: 90,732,832	E1314*	probably null	Het
Nwd2	C	T	5: 63,806,072	Q1000*	probably null	Het
Olfr1277	T	G	2: 111,270,310	D19A	probably benign	Het
Olfr1284	T	C	2: 111,379,834	V278A	possibly damaging	Het
Olfr790	T	A	10: 129,501,514	V210E	probably damaging	Het
Olfr792	A	C	10: 129,541,265	M243L	probably benign	Het
Ppp4r4	T	A	12: 103,606,888		probably null	Het
Pramef25	A	T	4: 143,949,095	I387N	possibly damaging	Het
Psg27	C	A	7: 18,557,033	R415L	probably benign	Het
Ptprr	T	A	10: 116,188,419	S212T	probably benign	Het
Ramp3	T	C	11: 6,674,888	F61L	probably damaging	Het
Rap1gds1	A	G	3: 138,958,628	L322P	probably damaging	Het
Rnf5	A	G	17: 34,601,588	F175S	probably benign	Het
Sema4a	G	A	3: 88,437,036	S636F	probably damaging	Het
Sfrp2	A	G	3: 83,769,401	D193G	probably damaging	Het
Slc26a5	T	C	5: 21,847,260	S24G	probably damaging	Het
Spg21	A	G	9: 65,468,802	I31V	probably benign	Het
Tmem45a2	T	C	16: 57,039,007	D287G	possibly damaging	Het
Utrn	A	T	10: 12,727,769	D627E	probably damaging	Het
Vmn2r103	A	T	17: 19,793,034	N139I	probably benign	Het
Washc5	A	T	15: 59,345,528		probably null	Het
Zfp667	T	C	7: 6,305,467	I378T	probably benign	Het
Zfp949	A	C	9: 88,567,183	T14P	possibly damaging	Het

Other mutations in Cntnap5c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Cntnap5c	APN	17	58162277	missense	probably benign	0.00
IGL00543:Cntnap5c	APN	17	58294350	missense	probably benign
IGL00679:Cntnap5c	APN	17	58055678	missense	probably damaging	0.98
IGL00942:Cntnap5c	APN	17	57769598	missense	probably benign	0.03
IGL01352:Cntnap5c	APN	17	58293901	missense	probably benign	0.00
IGL01822:Cntnap5c	APN	17	58055705	missense	probably damaging	0.99
IGL01864:Cntnap5c	APN	17	58410242	missense	probably benign
IGL01922:Cntnap5c	APN	17	58330119	missense	possibly damaging	0.95
IGL02111:Cntnap5c	APN	17	58102108	missense	probably damaging	1.00
IGL02112:Cntnap5c	APN	17	58313858	missense	probably benign	0.00
IGL02259:Cntnap5c	APN	17	58034862	missense	probably damaging	0.98
IGL02270:Cntnap5c	APN	17	58034853	missense	probably benign	0.08
IGL02312:Cntnap5c	APN	17	58138699	missense	probably benign	0.09
IGL02456:Cntnap5c	APN	17	58407744	splice site	probably benign
IGL02755:Cntnap5c	APN	17	58364194	missense	probably benign	0.02
IGL02955:Cntnap5c	APN	17	57892102	splice site	probably benign
IGL03001:Cntnap5c	APN	17	58055639	missense	probably damaging	1.00
IGL03012:Cntnap5c	APN	17	58359234	missense	probably benign	0.01
IGL03243:Cntnap5c	APN	17	58102176	missense	probably benign	0.01
IGL03375:Cntnap5c	APN	17	58162205	missense	possibly damaging	0.94
IGL02802:Cntnap5c	UTSW	17	58305684	missense	probably benign	0.04
LCD18:Cntnap5c	UTSW	17	58162160	intron	probably benign
R0003:Cntnap5c	UTSW	17	58199017	missense	probably benign
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0041:Cntnap5c	UTSW	17	57876469	missense	probably benign	0.00
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0046:Cntnap5c	UTSW	17	58359300	missense	probably benign
R0179:Cntnap5c	UTSW	17	57769625	missense	probably benign	0.19
R0244:Cntnap5c	UTSW	17	58102168	missense	probably damaging	1.00
R0445:Cntnap5c	UTSW	17	58104743	missense	probably benign	0.01
R0626:Cntnap5c	UTSW	17	58042427	missense	probably benign	0.29
R0675:Cntnap5c	UTSW	17	58034995	missense	probably damaging	1.00
R0681:Cntnap5c	UTSW	17	58305555	missense	possibly damaging	0.91
R0699:Cntnap5c	UTSW	17	58042498	missense	probably damaging	1.00
R0927:Cntnap5c	UTSW	17	58042558	missense	possibly damaging	0.78
R1081:Cntnap5c	UTSW	17	58305525	missense	possibly damaging	0.90
R1132:Cntnap5c	UTSW	17	58294356	missense	probably damaging	1.00
R1175:Cntnap5c	UTSW	17	58364246	missense	possibly damaging	0.51
R1640:Cntnap5c	UTSW	17	58395294	missense	probably benign	0.01
R1664:Cntnap5c	UTSW	17	58293990	missense	probably benign	0.00
R1758:Cntnap5c	UTSW	17	58042550	missense	probably damaging	1.00
R1785:Cntnap5c	UTSW	17	58162291	missense	probably benign	0.00
R1789:Cntnap5c	UTSW	17	58013921	missense	probably damaging	1.00
R1968:Cntnap5c	UTSW	17	58359296	missense	probably damaging	1.00
R2041:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R2041:Cntnap5c	UTSW	17	58198989	missense	probably benign	0.02
R2073:Cntnap5c	UTSW	17	58305552	missense	possibly damaging	0.58
R2093:Cntnap5c	UTSW	17	58199000	missense	probably benign	0.00
R2134:Cntnap5c	UTSW	17	58407722	missense	probably damaging	1.00
R2153:Cntnap5c	UTSW	17	58055671	missense	possibly damaging	0.90
R2176:Cntnap5c	UTSW	17	58013946	missense	probably benign	0.04
R2256:Cntnap5c	UTSW	17	58330315	missense	probably benign	0.00
R2847:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2848:Cntnap5c	UTSW	17	57876392	missense	probably damaging	0.99
R2850:Cntnap5c	UTSW	17	58410348	utr 3 prime	probably benign
R3008:Cntnap5c	UTSW	17	58359209	missense	probably damaging	1.00
R3714:Cntnap5c	UTSW	17	57892067	nonsense	probably null
R3720:Cntnap5c	UTSW	17	58330202	missense	probably benign
R3755:Cntnap5c	UTSW	17	58104599	missense	possibly damaging	0.82
R4001:Cntnap5c	UTSW	17	58407740	critical splice donor site	probably null
R4619:Cntnap5c	UTSW	17	58410268	missense	probably benign
R5146:Cntnap5c	UTSW	17	58013847	missense	probably damaging	0.96
R5309:Cntnap5c	UTSW	17	58359254	missense	probably benign	0.05
R5722:Cntnap5c	UTSW	17	58313857	missense	probably benign	0.01
R5974:Cntnap5c	UTSW	17	57876485	missense	probably benign	0.00
R6017:Cntnap5c	UTSW	17	58104698	missense	probably benign	0.41
R6059:Cntnap5c	UTSW	17	58313712	missense	probably damaging	0.99
R6152:Cntnap5c	UTSW	17	58286886	missense	possibly damaging	0.65
R6182:Cntnap5c	UTSW	17	57876395	missense	probably benign	0.00
R6298:Cntnap5c	UTSW	17	58104752	missense	probably damaging	1.00
R6301:Cntnap5c	UTSW	17	57892037	missense	probably benign	0.01
R6514:Cntnap5c	UTSW	17	58330170	missense	probably damaging	0.96
R6583:Cntnap5c	UTSW	17	58330277	missense	probably damaging	1.00
R6688:Cntnap5c	UTSW	17	58293904	missense	possibly damaging	0.71
R6781:Cntnap5c	UTSW	17	58138653	nonsense	probably null
R6866:Cntnap5c	UTSW	17	58092294	missense	probably benign
R6906:Cntnap5c	UTSW	17	58395307	missense	probably benign	0.18
R6911:Cntnap5c	UTSW	17	57892014	missense	probably damaging	1.00
R6919:Cntnap5c	UTSW	17	58293953	missense	probably benign	0.02
R6923:Cntnap5c	UTSW	17	58092350	missense	possibly damaging	0.96
R6925:Cntnap5c	UTSW	17	58395266	missense	probably benign	0.39
R6982:Cntnap5c	UTSW	17	58092252	missense	possibly damaging	0.77
R7144:Cntnap5c	UTSW	17	58286888	missense	probably benign
R7422:Cntnap5c	UTSW	17	58410231	nonsense	probably null
R7797:Cntnap5c	UTSW	17	58359275	missense	probably benign	0.11
R7830:Cntnap5c	UTSW	17	58162250	missense	probably damaging	1.00
R8169:Cntnap5c	UTSW	17	58104770	critical splice donor site	probably null
R8351:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8352:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8451:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8452:Cntnap5c	UTSW	17	58055692	missense	probably damaging	1.00
R8696:Cntnap5c	UTSW	17	58294299	missense	probably damaging	1.00
R8725:Cntnap5c	UTSW	17	58055668	missense	probably damaging	1.00
R8838:Cntnap5c	UTSW	17	57891969	missense
RF010:Cntnap5c	UTSW	17	58286795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACACACTCACTTTAATTAGTACCTGC -3'
(R):5'- TGCAGTCTGTGGCAACTCTG -3'

Sequencing Primer
(F):5'- TCACTTTAATTAGTACCTGCATTCAG -3'
(R):5'- GGCAACTCTGTGCTCCAGTATG -3'

Posted On

2016-07-22