Incidental Mutation 'R5313:Zbtb7b'
ID 405685
Institutional Source Beutler Lab
Gene Symbol Zbtb7b
Ensembl Gene ENSMUSG00000028042
Gene Name zinc finger and BTB domain containing 7B
Synonyms Thpok, c-Krox, Zfp67
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock # R5313 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 89377644-89394776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89381319 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 64 (T64K)
Ref Sequence ENSEMBL: ENSMUSP00000115425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029677] [ENSMUST00000107432] [ENSMUST00000107433] [ENSMUST00000107435] [ENSMUST00000124783] [ENSMUST00000126027] [ENSMUST00000142119] [ENSMUST00000148361] [ENSMUST00000208216]
AlphaFold Q64321
Predicted Effect probably damaging
Transcript: ENSMUST00000029677
AA Change: T64K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029677
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
BTB 34 145 1.45e-26 SMART
low complexity region 167 176 N/A INTRINSIC
low complexity region 184 211 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
ZnF_C2H2 350 372 5.72e-1 SMART
ZnF_C2H2 378 400 5.99e-4 SMART
ZnF_C2H2 406 428 3.83e-2 SMART
ZnF_C2H2 434 454 8.98e0 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 511 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107432
AA Change: T64K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103055
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
BTB 34 145 1.45e-26 SMART
low complexity region 167 176 N/A INTRINSIC
low complexity region 184 211 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
ZnF_C2H2 350 372 5.72e-1 SMART
ZnF_C2H2 378 400 5.99e-4 SMART
ZnF_C2H2 406 428 3.83e-2 SMART
ZnF_C2H2 434 454 8.98e0 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 511 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107433
AA Change: T64K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103056
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
BTB 34 145 1.45e-26 SMART
low complexity region 167 176 N/A INTRINSIC
low complexity region 184 211 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
ZnF_C2H2 350 372 5.72e-1 SMART
ZnF_C2H2 378 400 5.99e-4 SMART
ZnF_C2H2 406 428 3.83e-2 SMART
ZnF_C2H2 434 454 8.98e0 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 511 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107435
AA Change: T64K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103058
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
BTB 34 145 1.45e-26 SMART
low complexity region 167 176 N/A INTRINSIC
low complexity region 184 211 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
ZnF_C2H2 350 372 5.72e-1 SMART
ZnF_C2H2 378 400 5.99e-4 SMART
ZnF_C2H2 406 428 3.83e-2 SMART
ZnF_C2H2 434 454 8.98e0 SMART
low complexity region 477 486 N/A INTRINSIC
low complexity region 511 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124783
Predicted Effect probably damaging
Transcript: ENSMUST00000126027
AA Change: T64K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123348
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
BTB 34 124 1.36e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142119
AA Change: T64K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115425
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
Pfam:BTB 24 112 2.7e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148361
AA Change: T64K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121498
Gene: ENSMUSG00000028042
AA Change: T64K

DomainStartEndE-ValueType
Pfam:BTB 24 102 1.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208216
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger-containing transcription factor that acts as a key regulator of lineage commitment of immature T-cell precursors. It is necessary and sufficient for commitment of CD4 lineage, while its absence causes CD8 commitment. It also functions as a transcriptional repressor of type I collagen genes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit absence of peripheral T cells of the CD4+CD8- MHC class II-restricted T helper subset due to a specific block in thymic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Other mutations in Zbtb7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01537:Zbtb7b APN 3 89379971 missense possibly damaging 0.88
IGL02812:Zbtb7b APN 3 89379774 missense probably damaging 0.97
R4826:Zbtb7b UTSW 3 89380773 missense probably benign 0.00
R5354:Zbtb7b UTSW 3 89379606 unclassified probably benign
R7151:Zbtb7b UTSW 3 89380902 missense probably benign 0.00
R7152:Zbtb7b UTSW 3 89380902 missense probably benign 0.00
R7250:Zbtb7b UTSW 3 89379669 missense probably benign 0.00
R7426:Zbtb7b UTSW 3 89381059 missense probably damaging 1.00
R8556:Zbtb7b UTSW 3 89393137 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATTTCCAGTAGCCGAGCAG -3'
(R):5'- TTGACCCTGCAGGAGAAGATG -3'

Sequencing Primer
(F):5'- TAGCCGAGCAGCTTGGAGTAC -3'
(R):5'- GGAGCCCCGAGGATGAC -3'
Posted On 2016-07-22