Mutagenetix > Incidental Mutations

Incidental Mutation 'R5313:Slc34a2'

405691

Institutional Source

Beutler Lab

Gene Symbol

Slc34a2

Ensembl Gene

ENSMUSG00000029188

Gene Name

solute carrier family 34 (sodium phosphate), member 2

Synonyms

D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b

MMRRC Submission

042896-MU

Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53038081-53071664 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53069339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 542 (K542N)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094787]

AlphaFold

Q9DBP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094787
AA Change: K601N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: K601N

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	252	2.3e-26	PFAM
Pfam:Na_Pi_cotrans	374	551	2.6e-17	PFAM
low complexity region	553	570	N/A	INTRINSIC
low complexity region	616	645	N/A	INTRINSIC
low complexity region	649	655	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147243

Predicted Effect

probably damaging
Transcript: ENSMUST00000168667
AA Change: K542N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000132328
Gene: ENSMUSG00000029188
AA Change: K542N

Domain	Start	End	E-Value	Type
Pfam:Na_Pi_cotrans	110	253	1.2e-33	PFAM
Pfam:Na_Pi_cotrans	379	517	4.1e-15	PFAM
low complexity region	557	586	N/A	INTRINSIC
low complexity region	590	596	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adam19	T	C	11: 46,131,776	C519R	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Arhgef18	A	G	8: 3,451,629		probably null	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc18a2	A	G	19: 59,293,843	K494R	probably benign	Het
Snd1	C	A	6: 28,668,601	T429K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Slc34a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Slc34a2	APN	5	53065608	missense	probably benign	0.06
IGL00845:Slc34a2	APN	5	53058354	splice site	probably benign
IGL01024:Slc34a2	APN	5	53067630	missense	possibly damaging	0.61
IGL01300:Slc34a2	APN	5	53068127	critical splice acceptor site	probably null
IGL01680:Slc34a2	APN	5	53060876	missense	probably damaging	1.00
IGL02226:Slc34a2	APN	5	53067731	missense	probably benign	0.12
IGL02682:Slc34a2	APN	5	53059238	missense	possibly damaging	0.64
IGL03294:Slc34a2	APN	5	53063998	missense	probably benign	0.00
tucumcari	UTSW	5	53064009	missense	possibly damaging	0.68
D4216:Slc34a2	UTSW	5	53065497	missense	probably benign	0.01
R0094:Slc34a2	UTSW	5	53063968	missense	probably benign	0.28
R0227:Slc34a2	UTSW	5	53069626	missense	possibly damaging	0.51
R0524:Slc34a2	UTSW	5	53064873	nonsense	probably null
R0836:Slc34a2	UTSW	5	53067707	missense	probably benign
R1525:Slc34a2	UTSW	5	53069506	missense	probably benign	0.00
R1655:Slc34a2	UTSW	5	53069419	missense	probably benign	0.00
R1753:Slc34a2	UTSW	5	53061391	missense	probably benign	0.37
R1838:Slc34a2	UTSW	5	53058436	missense	probably benign
R2361:Slc34a2	UTSW	5	53068145	missense	probably benign	0.10
R2405:Slc34a2	UTSW	5	53058181	missense	probably benign	0.04
R3688:Slc34a2	UTSW	5	53064832	missense	probably benign	0.06
R4108:Slc34a2	UTSW	5	53064009	missense	possibly damaging	0.68
R4176:Slc34a2	UTSW	5	53067568	missense	probably damaging	1.00
R4380:Slc34a2	UTSW	5	53069286	missense	probably damaging	1.00
R4464:Slc34a2	UTSW	5	53069182	missense	probably damaging	0.99
R4780:Slc34a2	UTSW	5	53069451	missense	probably damaging	1.00
R4816:Slc34a2	UTSW	5	53069020	missense	probably damaging	1.00
R4934:Slc34a2	UTSW	5	53067600	missense	probably damaging	1.00
R5265:Slc34a2	UTSW	5	53061434	missense	probably damaging	0.96
R5309:Slc34a2	UTSW	5	53069488	missense	probably damaging	0.96
R5884:Slc34a2	UTSW	5	53069380	missense	possibly damaging	0.46
R6084:Slc34a2	UTSW	5	53067647	missense	possibly damaging	0.91
R6310:Slc34a2	UTSW	5	53064797	critical splice acceptor site	probably null
R6568:Slc34a2	UTSW	5	53069134	missense	probably damaging	1.00
R6817:Slc34a2	UTSW	5	53064028	missense	probably damaging	0.98
R6845:Slc34a2	UTSW	5	53069169	missense	probably damaging	0.96
R6944:Slc34a2	UTSW	5	53064883	missense	probably benign
R7873:Slc34a2	UTSW	5	53058372	missense	probably benign	0.02
R8114:Slc34a2	UTSW	5	53068359	missense	probably benign	0.00
R8158:Slc34a2	UTSW	5	53060840	missense	probably damaging	1.00
R8364:Slc34a2	UTSW	5	53068374	missense	possibly damaging	0.75
R9158:Slc34a2	UTSW	5	53063875	missense	possibly damaging	0.95
R9235:Slc34a2	UTSW	5	53069325	missense	probably benign	0.00
R9314:Slc34a2	UTSW	5	53060801	missense	possibly damaging	0.61
Z1176:Slc34a2	UTSW	5	53060817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACAGTGTTTGGCCTGTCTC -3'
(R):5'- ATGCTCAGAACTTCCACTTGG -3'

Sequencing Primer
(F):5'- CCTGTCTCTGGCAGGCTG -3'
(R):5'- TAGCTGCATTGTCAAAGGCC -3'

Posted On

2016-07-22