Incidental Mutation 'R5313:Slc34a2'
ID 405691
Institutional Source Beutler Lab
Gene Symbol Slc34a2
Ensembl Gene ENSMUSG00000029188
Gene Name solute carrier family 34 (sodium phosphate), member 2
Synonyms D5Ertd227e, type IIb Na/Picotransporter, Npt2b, NaPi-2b
MMRRC Submission 042896-MU
Accession Numbers

Genbank: NM_011402; MGI: 1342284

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5313 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 53038081-53071664 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53069339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 542 (K542N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094787]
AlphaFold Q9DBP0
Predicted Effect possibly damaging
Transcript: ENSMUST00000094787
AA Change: K601N

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092380
Gene: ENSMUSG00000029188
AA Change: K601N

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 252 2.3e-26 PFAM
Pfam:Na_Pi_cotrans 374 551 2.6e-17 PFAM
low complexity region 553 570 N/A INTRINSIC
low complexity region 616 645 N/A INTRINSIC
low complexity region 649 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147243
Predicted Effect probably damaging
Transcript: ENSMUST00000168667
AA Change: K542N

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132328
Gene: ENSMUSG00000029188
AA Change: K542N

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 110 253 1.2e-33 PFAM
Pfam:Na_Pi_cotrans 379 517 4.1e-15 PFAM
low complexity region 557 586 N/A INTRINSIC
low complexity region 590 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, embryonic growth arrest, failure of embryo turning and somitogenesis, impaired placental development and impaired yolk sac vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Slc34a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Slc34a2 APN 5 53065608 missense probably benign 0.06
IGL00845:Slc34a2 APN 5 53058354 splice site probably benign
IGL01024:Slc34a2 APN 5 53067630 missense possibly damaging 0.61
IGL01300:Slc34a2 APN 5 53068127 critical splice acceptor site probably null
IGL01680:Slc34a2 APN 5 53060876 missense probably damaging 1.00
IGL02226:Slc34a2 APN 5 53067731 missense probably benign 0.12
IGL02682:Slc34a2 APN 5 53059238 missense possibly damaging 0.64
IGL03294:Slc34a2 APN 5 53063998 missense probably benign 0.00
tucumcari UTSW 5 53064009 missense possibly damaging 0.68
D4216:Slc34a2 UTSW 5 53065497 missense probably benign 0.01
R0094:Slc34a2 UTSW 5 53063968 missense probably benign 0.28
R0227:Slc34a2 UTSW 5 53069626 missense possibly damaging 0.51
R0524:Slc34a2 UTSW 5 53064873 nonsense probably null
R0836:Slc34a2 UTSW 5 53067707 missense probably benign
R1525:Slc34a2 UTSW 5 53069506 missense probably benign 0.00
R1655:Slc34a2 UTSW 5 53069419 missense probably benign 0.00
R1753:Slc34a2 UTSW 5 53061391 missense probably benign 0.37
R1838:Slc34a2 UTSW 5 53058436 missense probably benign
R2361:Slc34a2 UTSW 5 53068145 missense probably benign 0.10
R2405:Slc34a2 UTSW 5 53058181 missense probably benign 0.04
R3688:Slc34a2 UTSW 5 53064832 missense probably benign 0.06
R4108:Slc34a2 UTSW 5 53064009 missense possibly damaging 0.68
R4176:Slc34a2 UTSW 5 53067568 missense probably damaging 1.00
R4380:Slc34a2 UTSW 5 53069286 missense probably damaging 1.00
R4464:Slc34a2 UTSW 5 53069182 missense probably damaging 0.99
R4780:Slc34a2 UTSW 5 53069451 missense probably damaging 1.00
R4816:Slc34a2 UTSW 5 53069020 missense probably damaging 1.00
R4934:Slc34a2 UTSW 5 53067600 missense probably damaging 1.00
R5265:Slc34a2 UTSW 5 53061434 missense probably damaging 0.96
R5309:Slc34a2 UTSW 5 53069488 missense probably damaging 0.96
R5884:Slc34a2 UTSW 5 53069380 missense possibly damaging 0.46
R6084:Slc34a2 UTSW 5 53067647 missense possibly damaging 0.91
R6310:Slc34a2 UTSW 5 53064797 critical splice acceptor site probably null
R6568:Slc34a2 UTSW 5 53069134 missense probably damaging 1.00
R6817:Slc34a2 UTSW 5 53064028 missense probably damaging 0.98
R6845:Slc34a2 UTSW 5 53069169 missense probably damaging 0.96
R6944:Slc34a2 UTSW 5 53064883 missense probably benign
R7873:Slc34a2 UTSW 5 53058372 missense probably benign 0.02
R8114:Slc34a2 UTSW 5 53068359 missense probably benign 0.00
R8158:Slc34a2 UTSW 5 53060840 missense probably damaging 1.00
R8364:Slc34a2 UTSW 5 53068374 missense possibly damaging 0.75
R9158:Slc34a2 UTSW 5 53063875 missense possibly damaging 0.95
R9235:Slc34a2 UTSW 5 53069325 missense probably benign 0.00
R9314:Slc34a2 UTSW 5 53060801 missense possibly damaging 0.61
Z1176:Slc34a2 UTSW 5 53060817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTGTTTGGCCTGTCTC -3'
(R):5'- ATGCTCAGAACTTCCACTTGG -3'

Sequencing Primer
(F):5'- CCTGTCTCTGGCAGGCTG -3'
(R):5'- TAGCTGCATTGTCAAAGGCC -3'
Posted On 2016-07-22