Incidental Mutation 'R5313:Tmprss11a'
ID405692
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86411815 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 373 (Y373N)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably damaging
Transcript: ENSMUST00000101073
AA Change: Y373N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: Y373N

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198504
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86414588 missense probably benign 0.10
R1704:Tmprss11a UTSW 5 86428702 missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86428652 missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86411809 nonsense probably null
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
R7962:Tmprss11a UTSW 5 86420020 missense probably damaging 1.00
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACATTGCTAGGTCCAGCC -3'
(R):5'- CGTGGTTCTTAAGGTGATATTCAGATC -3'

Sequencing Primer
(F):5'- ACATTGCTAGGTCCAGCCATTTAATC -3'
(R):5'- CATCTCATGTCCAGCAGTAGATG -3'
Posted On2016-07-22