Mutagenetix > Incidental Mutation

Incidental Mutation 'R5313:Snd1'

405694

Institutional Source

Beutler Lab

Gene Symbol

Snd1

Ensembl Gene

ENSMUSG00000001424

Gene Name

staphylococcal nuclease and tudor domain containing 1

Synonyms

p100 co-activator, Tudor-SN

MMRRC Submission

042896-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.927) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28475139-28935162 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 28668601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 429 (T429K)

Ref Sequence

ENSEMBL: ENSMUSP00000128737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000164915] [ENSMUST00000167201] [ENSMUST00000171353]

AlphaFold

Q78PY7

Predicted Effect

probably benign
Transcript: ENSMUST00000001460
AA Change: T429K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: T429K

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SNc	525	660	3.82e-45	SMART
TUDOR	728	785	4.8e-19	SMART
Pfam:SNase	835	895	1.3e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164915

SMART Domains

Protein: ENSMUSP00000127317
Gene: ENSMUSG00000001424

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	142	1.56e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167201
AA Change: T429K

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424
AA Change: T429K

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
SNc	18	166	7.12e-54	SMART
SNc	193	328	8.37e-51	SMART
SNc	341	496	4.11e-59	SMART
SCOP:d1sty__	526	592	1e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171353

SMART Domains

Protein: ENSMUSP00000129497
Gene: ENSMUSG00000049939

Domain	Start	End	E-Value	Type
low complexity region	29	39	N/A	INTRINSIC
transmembrane domain	104	126	N/A	INTRINSIC
low complexity region	152	163	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171532

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adam19	T	C	11: 46,131,776	C519R	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Arhgef18	A	G	8: 3,451,629		probably null	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc18a2	A	G	19: 59,293,843	K494R	probably benign	Het
Slc34a2	A	T	5: 53,069,339	K542N	probably damaging	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Snd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00933:Snd1	APN	6	28512986	critical splice donor site	probably null
IGL00940:Snd1	APN	6	28745175	intron	probably benign
IGL01340:Snd1	APN	6	28883369	missense	probably benign
IGL01892:Snd1	APN	6	28888124	critical splice donor site	probably null
IGL02063:Snd1	APN	6	28526221	unclassified	probably benign
IGL02134:Snd1	APN	6	28880279	missense	possibly damaging	0.81
IGL02366:Snd1	APN	6	28707150	intron	probably benign
PIT4677001:Snd1	UTSW	6	28880296	missense	probably benign	0.01
R0039:Snd1	UTSW	6	28745210	missense	probably damaging	1.00
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0053:Snd1	UTSW	6	28745335	intron	probably benign
R0463:Snd1	UTSW	6	28724956	missense	probably benign	0.00
R0576:Snd1	UTSW	6	28886577	missense	probably benign	0.31
R0709:Snd1	UTSW	6	28545470	splice site	probably benign
R0959:Snd1	UTSW	6	28884971	missense	probably benign	0.01
R1698:Snd1	UTSW	6	28888253	nonsense	probably null
R1853:Snd1	UTSW	6	28545564	missense	probably damaging	1.00
R2059:Snd1	UTSW	6	28745207	missense	probably damaging	1.00
R2497:Snd1	UTSW	6	28888079	missense	probably benign
R3832:Snd1	UTSW	6	28531404	splice site	probably benign
R3833:Snd1	UTSW	6	28531404	splice site	probably benign
R4643:Snd1	UTSW	6	28880249	missense	probably benign	0.00
R4665:Snd1	UTSW	6	28707054	missense	probably damaging	1.00
R4843:Snd1	UTSW	6	28668643	missense	probably damaging	1.00
R4884:Snd1	UTSW	6	28526912	missense	possibly damaging	0.94
R4959:Snd1	UTSW	6	28884251	nonsense	probably null
R4973:Snd1	UTSW	6	28884251	nonsense	probably null
R5065:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5066:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5067:Snd1	UTSW	6	28888240	missense	probably damaging	1.00
R5131:Snd1	UTSW	6	28885050	missense	probably damaging	0.99
R5172:Snd1	UTSW	6	28886616	missense	possibly damaging	0.91
R5239:Snd1	UTSW	6	28545525	missense	probably damaging	1.00
R5395:Snd1	UTSW	6	28526184	missense	probably damaging	0.99
R5938:Snd1	UTSW	6	28874859	critical splice acceptor site	probably null
R6019:Snd1	UTSW	6	28880234	missense	probably benign	0.00
R6248:Snd1	UTSW	6	28520235	nonsense	probably null
R6337:Snd1	UTSW	6	28888289	missense	probably damaging	1.00
R6810:Snd1	UTSW	6	28668610	missense	probably benign	0.23
R6932:Snd1	UTSW	6	28626101	missense	probably benign	0.42
R7469:Snd1	UTSW	6	28626127	missense	probably damaging	1.00
R7485:Snd1	UTSW	6	28531450	missense	probably benign	0.14
R7571:Snd1	UTSW	6	28526203	missense	possibly damaging	0.81
R7866:Snd1	UTSW	6	28527725	missense	probably damaging	1.00
R8178:Snd1	UTSW	6	28874976	missense	possibly damaging	0.85
R8208:Snd1	UTSW	6	28526055	missense	possibly damaging	0.86
R8526:Snd1	UTSW	6	28745254	missense	probably benign	0.00
R8848:Snd1	UTSW	6	28874963	missense	possibly damaging	0.72
R8854:Snd1	UTSW	6	28526969	missense	probably benign	0.02
R9310:Snd1	UTSW	6	28795937	missense	probably null	1.00
R9326:Snd1	UTSW	6	28795843	nonsense	probably null
R9348:Snd1	UTSW	6	28745207	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGTGCTGTCCTTTATCCAATG -3'
(R):5'- TAGTCCACTGGGTTAAGGACAAGAG -3'

Sequencing Primer
(F):5'- AATGCCTTTTGGAGATCTTTCTGC -3'
(R):5'- CACTGGGTTAAGGACAAGAGAGAGC -3'

Posted On

2016-07-22