Incidental Mutation 'R5313:Fam234b'
ID405696
Institutional Source Beutler Lab
Gene Symbol Fam234b
Ensembl Gene ENSMUSG00000030207
Gene Namefamily with sequence similarity 234, member B
Synonyms8430419L09Rik
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location135197977-135244955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135209187 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 64 (D64E)
Ref Sequence ENSEMBL: ENSMUSP00000107547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111915] [ENSMUST00000111916] [ENSMUST00000130612] [ENSMUST00000151071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111915
AA Change: D64E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107546
Gene: ENSMUSG00000030207
AA Change: D64E

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111916
AA Change: D64E

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107547
Gene: ENSMUSG00000030207
AA Change: D64E

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
low complexity region 500 517 N/A INTRINSIC
low complexity region 521 528 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130612
AA Change: M34K
Predicted Effect unknown
Transcript: ENSMUST00000151071
AA Change: M34K
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Fam234b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Fam234b APN 6 135225204 missense probably damaging 1.00
IGL01020:Fam234b APN 6 135211906 missense probably benign 0.13
IGL01731:Fam234b APN 6 135211905 missense possibly damaging 0.90
IGL01994:Fam234b APN 6 135225205 nonsense probably null
IGL02010:Fam234b APN 6 135209407 missense probably benign 0.17
IGL02071:Fam234b APN 6 135227151 critical splice acceptor site probably null
IGL02340:Fam234b APN 6 135231661 missense probably damaging 1.00
IGL02869:Fam234b APN 6 135225203 missense probably damaging 1.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0076:Fam234b UTSW 6 135227226 missense probably benign 0.00
R0123:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0127:Fam234b UTSW 6 135218823 splice site probably benign
R0225:Fam234b UTSW 6 135217074 missense possibly damaging 0.46
R0570:Fam234b UTSW 6 135209249 missense probably benign 0.00
R0705:Fam234b UTSW 6 135227215 missense probably benign 0.11
R1140:Fam234b UTSW 6 135225758 missense probably benign 0.00
R1446:Fam234b UTSW 6 135209330 splice site probably null
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R1464:Fam234b UTSW 6 135228492 missense probably benign 0.00
R2044:Fam234b UTSW 6 135226914 missense probably benign 0.04
R2350:Fam234b UTSW 6 135231724 missense probably damaging 1.00
R3914:Fam234b UTSW 6 135225683 missense probably damaging 1.00
R4261:Fam234b UTSW 6 135209136 missense unknown
R5102:Fam234b UTSW 6 135209284 missense probably benign 0.03
R5133:Fam234b UTSW 6 135209195 missense probably benign 0.01
R5375:Fam234b UTSW 6 135233357 missense probably damaging 1.00
R5418:Fam234b UTSW 6 135226968 missense probably benign 0.00
R5838:Fam234b UTSW 6 135225267 missense probably benign 0.00
R5953:Fam234b UTSW 6 135225707 missense possibly damaging 0.95
R6737:Fam234b UTSW 6 135228515 missense probably damaging 0.99
R7056:Fam234b UTSW 6 135228452 missense probably benign 0.32
R7221:Fam234b UTSW 6 135228531 missense probably damaging 1.00
R7418:Fam234b UTSW 6 135217011 missense probably benign 0.04
R7459:Fam234b UTSW 6 135211901 missense probably benign 0.04
R7599:Fam234b UTSW 6 135226876 missense probably damaging 1.00
R7602:Fam234b UTSW 6 135225243 missense possibly damaging 0.79
R7639:Fam234b UTSW 6 135225800 splice site probably null
R7748:Fam234b UTSW 6 135209351 missense probably damaging 1.00
R7773:Fam234b UTSW 6 135243914 missense probably benign 0.01
R8544:Fam234b UTSW 6 135233289 missense probably damaging 1.00
Z1177:Fam234b UTSW 6 135198008 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCTGTCTGACTTTCCAGGG -3'
(R):5'- CTGGAGGGAAACTTGAGTGC -3'

Sequencing Primer
(F):5'- CTCTGTCTGACTTTCCAGGGAAGAAG -3'
(R):5'- GGGAAACTTGAGTGCACTAACTTATG -3'
Posted On2016-07-22