Mutagenetix > Incidental Mutations

Incidental Mutation 'R5313:Arhgef18'

405703

Institutional Source

Beutler Lab

Gene Symbol

Arhgef18

Ensembl Gene

ENSMUSG00000004568

Gene Name

rho/rac guanine nucleotide exchange factor (GEF) 18

Synonyms

D030053O22Rik

MMRRC Submission

042896-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3393006-3456601 bp(+) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

A to G at 3451629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000004684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004684]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000004684

SMART Domains

Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568

Domain	Start	End	E-Value	Type
RhoGEF	105	297	2.62e-58	SMART
PH	340	443	5.57e-12	SMART
low complexity region	446	456	N/A	INTRINSIC
low complexity region	646	663	N/A	INTRINSIC
coiled coil region	697	800	N/A	INTRINSIC
low complexity region	887	897	N/A	INTRINSIC
low complexity region	905	919	N/A	INTRINSIC
low complexity region	963	985	N/A	INTRINSIC
low complexity region	991	1010	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131773

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145360

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156085

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adam19	T	C	11: 46,131,776	C519R	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc18a2	A	G	19: 59,293,843	K494R	probably benign	Het
Slc34a2	A	T	5: 53,069,339	K542N	probably damaging	Het
Snd1	C	A	6: 28,668,601	T429K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Arhgef18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Arhgef18	APN	8	3429553	missense	probably damaging	1.00
IGL01649:Arhgef18	APN	8	3441211	splice site	probably benign
IGL01736:Arhgef18	APN	8	3451624	splice site	probably benign
IGL02206:Arhgef18	APN	8	3445034	missense	probably benign	0.00
IGL02401:Arhgef18	APN	8	3437078	missense	probably damaging	1.00
IGL02938:Arhgef18	APN	8	3450802	missense	probably benign	0.02
IGL02943:Arhgef18	APN	8	3448553	missense	probably damaging	0.99
IGL02990:Arhgef18	APN	8	3444904	missense	probably benign	0.02
IGL03162:Arhgef18	APN	8	3441301	splice site	probably null
R1622:Arhgef18	UTSW	8	3441272	missense	possibly damaging	0.46
R1681:Arhgef18	UTSW	8	3439645	missense	probably damaging	1.00
R1726:Arhgef18	UTSW	8	3454228	missense	possibly damaging	0.46
R2126:Arhgef18	UTSW	8	3451939	missense	probably damaging	0.99
R2161:Arhgef18	UTSW	8	3439575	nonsense	probably null
R2878:Arhgef18	UTSW	8	3432759	missense	probably benign
R3916:Arhgef18	UTSW	8	3454197	missense	probably benign
R4231:Arhgef18	UTSW	8	3450317	missense	possibly damaging	0.80
R4233:Arhgef18	UTSW	8	3450317	missense	possibly damaging	0.80
R4234:Arhgef18	UTSW	8	3450317	missense	possibly damaging	0.80
R4235:Arhgef18	UTSW	8	3450317	missense	possibly damaging	0.80
R4236:Arhgef18	UTSW	8	3450317	missense	possibly damaging	0.80
R4450:Arhgef18	UTSW	8	3437097	missense	probably damaging	0.97
R4539:Arhgef18	UTSW	8	3447070	missense	probably benign
R4670:Arhgef18	UTSW	8	3434897	missense	probably damaging	1.00
R4753:Arhgef18	UTSW	8	3444938	missense	probably damaging	1.00
R4897:Arhgef18	UTSW	8	3444979	missense	probably benign
R5698:Arhgef18	UTSW	8	3439499	missense	probably damaging	0.99
R5781:Arhgef18	UTSW	8	3439439	splice site	probably null
R5851:Arhgef18	UTSW	8	3434980	missense	probably damaging	1.00
R5897:Arhgef18	UTSW	8	3439682	missense	probably damaging	1.00
R5908:Arhgef18	UTSW	8	3453165	missense	probably damaging	1.00
R6123:Arhgef18	UTSW	8	3437091	missense	probably damaging	0.99
R6136:Arhgef18	UTSW	8	3454507	missense	probably benign
R6240:Arhgef18	UTSW	8	3439658	missense	probably damaging	1.00
R6617:Arhgef18	UTSW	8	3439592	missense	probably damaging	1.00
R7575:Arhgef18	UTSW	8	3451635	missense	probably damaging	0.99
R7851:Arhgef18	UTSW	8	3448409	missense	possibly damaging	0.46
R7947:Arhgef18	UTSW	8	3432775	missense	probably damaging	1.00
R8030:Arhgef18	UTSW	8	3439600	missense	probably damaging	1.00
R8848:Arhgef18	UTSW	8	3427481	missense	probably benign	0.00
R9038:Arhgef18	UTSW	8	3453257	missense	probably benign	0.30
R9131:Arhgef18	UTSW	8	3437007	missense	possibly damaging	0.77
R9229:Arhgef18	UTSW	8	3429314	missense	probably benign	0.01
X0021:Arhgef18	UTSW	8	3434942	missense	probably damaging	1.00
Z1088:Arhgef18	UTSW	8	3439628	missense	probably damaging	1.00
Z1176:Arhgef18	UTSW	8	3453224	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCACTGAGTTCTGTCTCC -3'
(R):5'- ATCCTGTTGAGCGATGACCG -3'

Sequencing Primer
(F):5'- GGTGGTTTAGATCCCATTTGATAC -3'
(R):5'- GATGACCGCCTGGGGAC -3'

Posted On

2016-07-22