Mutagenetix > Incidental Mutations

Incidental Mutation 'R5313:Adam19'

405707

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

MMRRC Submission

042896-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46131776 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 519 (C519R)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

Predicted Effect

probably damaging
Transcript: ENSMUST00000011400
AA Change: C519R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: C519R

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151565

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153410

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Arhgef18	A	G	8: 3,451,629		probably null	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc18a2	A	G	19: 59,293,843	K494R	probably benign	Het
Slc34a2	A	T	5: 53,069,339	K542N	probably damaging	Het
Snd1	C	A	6: 28,668,601	T429K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0488:Adam19	UTSW	11	46138930	missense	probably damaging	0.98
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	intron	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4506:Adam19	UTSW	11	46118444	missense	possibly damaging	0.67
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R5602:Adam19	UTSW	11	46136315	missense	probably benign
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R7979:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- GCGGTGATAACAAGGTCGTC -3'
(R):5'- TGAGAAATACTGTCACTCTTGAGC -3'

Sequencing Primer
(F):5'- CCACAGATAGGATGTTCATGAGCTC -3'
(R):5'- CTAAGAGCATGAGATGTGGTATTTG -3'

Posted On

2016-07-22