Mutagenetix > Incidental Mutations

Incidental Mutation 'R0497:Afap1l2'

40571

Institutional Source

Beutler Lab

Gene Symbol

Afap1l2

Ensembl Gene

ENSMUSG00000025083

Gene Name

actin filament associated protein 1-like 2

Synonyms

MMRRC Submission

038693-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R0497 (G1)

Quality Score

143

Status

Validated

Chromosome

Chromosomal Location

56912361-57008228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 56930209 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 171 (N171K)

Ref Sequence

ENSEMBL: ENSMUSP00000107210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359] [ENSMUST00000126964] [ENSMUST00000148049] [ENSMUST00000225394]

Predicted Effect

probably benign
Transcript: ENSMUST00000111584
AA Change: N171K

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: N171K

Domain	Start	End	E-Value	Type
Blast:PH	30	153	3e-60	BLAST
low complexity region	160	170	N/A	INTRINSIC
PH	194	291	9.27e-9	SMART
PH	372	467	3.11e-10	SMART
low complexity region	531	543	N/A	INTRINSIC
low complexity region	611	626	N/A	INTRINSIC
coiled coil region	675	772	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118800
AA Change: N153K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: N153K

Domain	Start	End	E-Value	Type
Blast:PH	12	135	3e-60	BLAST
low complexity region	142	152	N/A	INTRINSIC
PH	176	273	9.27e-9	SMART
PH	354	449	3.11e-10	SMART
low complexity region	513	525	N/A	INTRINSIC
low complexity region	593	608	N/A	INTRINSIC
coiled coil region	657	754	N/A	INTRINSIC
low complexity region	773	786	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122359
AA Change: N97K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: N97K

Domain	Start	End	E-Value	Type
Blast:PH	1	79	3e-32	BLAST
low complexity region	86	96	N/A	INTRINSIC
PH	120	217	9.27e-9	SMART
PH	298	393	3.11e-10	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	537	552	N/A	INTRINSIC
coiled coil region	601	698	N/A	INTRINSIC
low complexity region	717	730	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126964
AA Change: N97K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000123400
Gene: ENSMUSG00000025083
AA Change: N97K

Domain	Start	End	E-Value	Type
Blast:PH	1	79	5e-36	BLAST
low complexity region	86	96	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148049
AA Change: N97K

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000120490
Gene: ENSMUSG00000025083
AA Change: N97K

Domain	Start	End	E-Value	Type
Blast:PH	1	79	2e-34	BLAST
low complexity region	86	96	N/A	INTRINSIC
PH	120	217	9.27e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155467

Predicted Effect

probably benign
Transcript: ENSMUST00000225394

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.7%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (68/68)

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	T	A	7: 28,147,465	C1158S	probably damaging	Het
Aatk	A	C	11: 120,018,780	V110G	probably damaging	Het
Adcy6	A	C	15: 98,597,725		probably null	Het
Adm	A	G	7: 110,629,121	T170A	probably benign	Het
Aph1b	G	T	9: 66,790,618	S112*	probably null	Het
Arhgap23	A	G	11: 97,452,163	S424G	probably damaging	Het
Asah2	T	A	19: 32,054,631	N46I	probably benign	Het
Braf	G	A	6: 39,640,549		probably benign	Het
Brd2	C	T	17: 34,114,360	R47Q	probably damaging	Het
C2cd5	A	G	6: 143,012,093	V972A	probably benign	Het
Car9	T	A	4: 43,511,881	L300H	probably damaging	Het
Chmp3	T	C	6: 71,552,411	S20P	probably damaging	Het
Chp1	A	G	2: 119,571,782	N79S	possibly damaging	Het
Cnot2	A	T	10: 116,498,355	I335N	probably damaging	Het
Cntnap4	T	C	8: 112,570,151	V6A	probably benign	Het
Ctcf	T	A	8: 105,675,040		probably benign	Het
Dennd1b	A	G	1: 139,039,986		probably benign	Het
Dirc2	A	T	16: 35,735,604	V162D	probably benign	Het
Dnmbp	A	G	19: 43,856,640		probably benign	Het
Eef2	T	C	10: 81,181,586	F782L	probably benign	Het
Eogt	T	A	6: 97,135,233	Y153F	probably benign	Het
Fam81a	G	T	9: 70,096,119	Q237K	possibly damaging	Het
Fat2	T	A	11: 55,283,402	T2162S	probably benign	Het
Gas6	T	C	8: 13,470,387	I434V	possibly damaging	Het
Gm42417	A	T	1: 36,532,167	L77Q	probably damaging	Het
Grik3	A	T	4: 125,623,510	N49Y	possibly damaging	Het
Gucy2e	A	T	11: 69,224,159	V974E	probably damaging	Het
Helz2	A	G	2: 181,229,656	V2721A	probably damaging	Het
Klhl6	GT	G	16: 19,956,966		probably null	Het
Krt73	A	G	15: 101,802,230	L23P	probably damaging	Het
L3mbtl3	T	C	10: 26,282,874		probably benign	Het
Lrrc15	A	T	16: 30,272,892	V543E	probably damaging	Het
Med13	G	A	11: 86,276,983		probably benign	Het
Med25	T	C	7: 44,892,100	D60G	probably damaging	Het
Mgam	T	A	6: 40,664,892	Y560N	probably damaging	Het
Mlkl	A	G	8: 111,327,873	Y211H	probably damaging	Het
Msl2	A	G	9: 101,101,294	N289S	probably benign	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr1281	A	G	2: 111,328,830	D137G	probably benign	Het
Omt2b	T	C	9: 78,328,231		probably benign	Het
Pald1	A	G	10: 61,341,315	L652P	probably damaging	Het
Pard3b	T	A	1: 62,440,008		probably null	Het
Prdm15	G	A	16: 97,794,334	T1098I	possibly damaging	Het
Rock2	A	G	12: 16,954,953	T436A	probably benign	Het
Sema4c	A	T	1: 36,549,608	D812E	probably benign	Het
Sla	A	T	15: 66,792,249	I91K	probably benign	Het
Slc22a16	T	G	10: 40,584,967	M255R	probably damaging	Het
Smg8	C	T	11: 87,086,084	D224N	possibly damaging	Het
Spdef	A	T	17: 27,718,058	D190E	probably benign	Het
Taok1	A	G	11: 77,573,804	I152T	probably damaging	Het
Tmem220	A	G	11: 67,025,922	D36G	probably damaging	Het
Tmem235	A	C	11: 117,864,351	I210L	probably benign	Het
Tmem266	C	T	9: 55,380,884		probably null	Het
Tmprss12	A	G	15: 100,281,039		probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Usp38	T	A	8: 80,984,424		probably benign	Het
Usp44	C	T	10: 93,846,806	P373S	possibly damaging	Het
Vmn1r209	G	T	13: 22,805,948	Q191K	probably damaging	Het
Vmn1r70	T	C	7: 10,634,026	I147T	probably benign	Het
Vmn2r107	T	A	17: 20,375,132	I649N	probably damaging	Het
Vmn2r12	A	T	5: 109,091,889	Y269*	probably null	Het
Zan	C	T	5: 137,412,676		probably benign	Het
Zfp616	G	T	11: 74,083,480	V192L	probably benign	Het
Zfp644	A	T	5: 106,638,333	V116D	probably damaging	Het
Zgrf1	T	C	3: 127,584,650		probably benign	Het
Zhx3	A	T	2: 160,779,994	L751*	probably null	Het
Znfx1	T	A	2: 167,055,411	Q531L	probably benign	Het

Other mutations in Afap1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Afap1l2	APN	19	57002308	splice site	probably benign
IGL01012:Afap1l2	APN	19	56930261	missense	probably damaging	0.98
IGL01089:Afap1l2	APN	19	56913411	splice site	probably null
IGL01150:Afap1l2	APN	19	56930186	missense	probably damaging	0.99
IGL02393:Afap1l2	APN	19	56914440	missense	probably damaging	1.00
IGL02887:Afap1l2	APN	19	56920563	missense	probably damaging	1.00
IGL03060:Afap1l2	APN	19	56914250	nonsense	probably null
R0102:Afap1l2	UTSW	19	56928440	unclassified	probably benign
R0102:Afap1l2	UTSW	19	56928440	unclassified	probably benign
R0282:Afap1l2	UTSW	19	56916221	missense	possibly damaging	0.65
R0388:Afap1l2	UTSW	19	56917242	splice site	probably benign
R0432:Afap1l2	UTSW	19	56917119	splice site	probably benign
R0578:Afap1l2	UTSW	19	56915782	missense	probably benign	0.04
R0631:Afap1l2	UTSW	19	56916085	missense	probably benign	0.39
R0670:Afap1l2	UTSW	19	56915803	missense	probably damaging	1.00
R1188:Afap1l2	UTSW	19	56925069	missense	probably damaging	0.97
R1236:Afap1l2	UTSW	19	56916472	missense	possibly damaging	0.64
R1274:Afap1l2	UTSW	19	56914563	missense	probably benign	0.02
R1463:Afap1l2	UTSW	19	56930151	missense	probably benign	0.01
R1497:Afap1l2	UTSW	19	56928311	missense	probably benign	0.25
R1597:Afap1l2	UTSW	19	56914449	missense	probably benign	0.14
R1778:Afap1l2	UTSW	19	56916206	missense	possibly damaging	0.68
R1795:Afap1l2	UTSW	19	56928409	missense	probably damaging	1.00
R1991:Afap1l2	UTSW	19	57002267	missense	possibly damaging	0.62
R2113:Afap1l2	UTSW	19	56913389	missense	possibly damaging	0.95
R2242:Afap1l2	UTSW	19	56914468	missense	possibly damaging	0.56
R3429:Afap1l2	UTSW	19	56915806	missense	probably damaging	1.00
R3430:Afap1l2	UTSW	19	56915806	missense	probably damaging	1.00
R3698:Afap1l2	UTSW	19	56916523	missense	possibly damaging	0.69
R4706:Afap1l2	UTSW	19	56937240	missense	possibly damaging	0.76
R4956:Afap1l2	UTSW	19	56943447	missense	probably benign	0.00
R4993:Afap1l2	UTSW	19	56918040	missense	probably damaging	1.00
R5772:Afap1l2	UTSW	19	56922974	missense	probably benign	0.02
R5878:Afap1l2	UTSW	19	56915675	missense	probably benign	0.01
R6194:Afap1l2	UTSW	19	56922951	missense	probably damaging	1.00
R6226:Afap1l2	UTSW	19	56916128	missense	probably benign	0.00
R6334:Afap1l2	UTSW	19	56917976	unclassified	probably null
R6439:Afap1l2	UTSW	19	56928386	missense	possibly damaging	0.91
R7332:Afap1l2	UTSW	19	56918121	missense	probably damaging	1.00
R7524:Afap1l2	UTSW	19	56918111	missense	probably damaging	1.00
R7577:Afap1l2	UTSW	19	56944767	missense	probably damaging	1.00
R7696:Afap1l2	UTSW	19	56914486	missense	probably damaging	1.00
X0062:Afap1l2	UTSW	19	56918033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAAGGACTGACCAAGAGCCTGGTG -3'
(R):5'- AAGATGTAGACCCAGCCTGGAAGC -3'

Sequencing Primer
(F):5'- GTGTCCCTGATCACACAGAG -3'
(R):5'- AAGCCATTGAGCTGTTTCAAGG -3'

Posted On

2013-05-23