Incidental Mutation 'R5313:Prpf4b'
ID405712
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34894549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 714 (V714A)
Ref Sequence ENSEMBL: ENSMUSP00000152654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect probably damaging
Transcript: ENSMUST00000077853
AA Change: V714A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: V714A

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect unknown
Transcript: ENSMUST00000220965
AA Change: V217A
Predicted Effect probably benign
Transcript: ENSMUST00000221077
Predicted Effect probably damaging
Transcript: ENSMUST00000222509
AA Change: V714A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Cpox T A 16: 58,677,948 Y381* probably null Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3802:Prpf4b UTSW 13 34883682 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
RF002:Prpf4b UTSW 13 34884236 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGAGATGACCATTGGAGGC -3'
(R):5'- AGGGTAGGTACTGAAATGACTTTG -3'

Sequencing Primer
(F):5'- CGGTGCCTGGATTCCATCATG -3'
(R):5'- GACATAATAGAACTTCCCATGTAACC -3'
Posted On2016-07-22