Mutagenetix > Incidental Mutations

Incidental Mutation 'R5313:Sntb1'

405716

Institutional Source

Beutler Lab

Gene Symbol

Sntb1

Ensembl Gene

ENSMUSG00000060429

Gene Name

syntrophin, basic 1

Synonyms

59-1 DAP, beta1-Syntrophin

MMRRC Submission

042896-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55636388-55906949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 55642795 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 461 (G461R)

Ref Sequence

ENSEMBL: ENSMUSP00000041294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039769]

AlphaFold

Q99L88

Predicted Effect

probably damaging
Transcript: ENSMUST00000039769
AA Change: G461R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: G461R

Domain	Start	End	E-Value	Type
PH	19	299	5.14e0	SMART
PDZ	120	194	4.5e-17	SMART
PH	322	434	2.81e-8	SMART

Meta Mutation Damage Score

0.7492

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adam19	T	C	11: 46,131,776	C519R	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Arhgef18	A	G	8: 3,451,629		probably null	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc18a2	A	G	19: 59,293,843	K494R	probably benign	Het
Slc34a2	A	T	5: 53,069,339	K542N	probably damaging	Het
Snd1	C	A	6: 28,668,601	T429K	probably benign	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Sntb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Sntb1	APN	15	55648039	missense	possibly damaging	0.93
IGL02732:Sntb1	APN	15	55792200	missense	possibly damaging	0.62
IGL02965:Sntb1	APN	15	55642685	nonsense	probably null
IGL03084:Sntb1	APN	15	55792091	missense	probably damaging	0.99
IGL03286:Sntb1	APN	15	55792046	missense	possibly damaging	0.59
R0117:Sntb1	UTSW	15	55906353	missense	probably benign
R0178:Sntb1	UTSW	15	55906144	missense	probably damaging	0.98
R0465:Sntb1	UTSW	15	55749276	missense	probably benign	0.02
R0626:Sntb1	UTSW	15	55642783	missense	probably benign	0.20
R0726:Sntb1	UTSW	15	55676356	missense	probably benign
R1125:Sntb1	UTSW	15	55749280	missense	probably benign
R1443:Sntb1	UTSW	15	55647955	missense	probably damaging	1.00
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R1888:Sntb1	UTSW	15	55749349	nonsense	probably null
R2208:Sntb1	UTSW	15	55906318	missense	possibly damaging	0.79
R2426:Sntb1	UTSW	15	55906179	missense	probably damaging	1.00
R3721:Sntb1	UTSW	15	55642818	missense	probably benign	0.10
R4370:Sntb1	UTSW	15	55792091	missense	probably damaging	0.99
R4706:Sntb1	UTSW	15	55749274	missense	probably benign	0.09
R4883:Sntb1	UTSW	15	55642802	nonsense	probably null
R5223:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5242:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5270:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5314:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5316:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5336:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5337:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5396:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5398:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5427:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5428:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5429:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5431:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5594:Sntb1	UTSW	15	55642795	missense	probably damaging	1.00
R5658:Sntb1	UTSW	15	55792076	missense	probably damaging	1.00
R5665:Sntb1	UTSW	15	55792139	missense	probably benign	0.00
R6147:Sntb1	UTSW	15	55648010	missense	probably benign
R6159:Sntb1	UTSW	15	55676302	critical splice donor site	probably null
R6883:Sntb1	UTSW	15	55906323	missense	probably benign	0.38
R7008:Sntb1	UTSW	15	55792072	nonsense	probably null
R7168:Sntb1	UTSW	15	55791265	missense	probably benign	0.00
R7511:Sntb1	UTSW	15	55647951	missense	possibly damaging	0.71
R7600:Sntb1	UTSW	15	55792188	missense	possibly damaging	0.82
R8242:Sntb1	UTSW	15	55792233	missense	possibly damaging	0.95
R8804:Sntb1	UTSW	15	55792127	missense	probably benign	0.37
R9280:Sntb1	UTSW	15	55906375	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAAGTAGTCAGGCCGCCTAC -3'
(R):5'- AAGAAATTCGTGGCTGGGCAC -3'

Sequencing Primer
(F):5'- ACTTCCAAGTCATTGCACATG -3'
(R):5'- CTGGGCACTGGGTTGAAG -3'

Posted On

2016-07-22