Incidental Mutation 'R5313:Cpox'
ID405717
Institutional Source Beutler Lab
Gene Symbol Cpox
Ensembl Gene ENSMUSG00000022742
Gene Namecoproporphyrinogen oxidase
Synonymsnct, Cpo, cac, clone 560
MMRRC Submission 042896-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R5313 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location58670292-58717636 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 58677948 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 381 (Y381*)
Ref Sequence ENSEMBL: ENSMUSP00000055455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060077]
Predicted Effect probably null
Transcript: ENSMUST00000060077
AA Change: Y381*
SMART Domains Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: Y381*

DomainStartEndE-ValueType
low complexity region 57 81 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
Pfam:Coprogen_oxidas 140 442 7.6e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232532
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,709,268 E1027K probably damaging Het
9130011E15Rik G A 19: 45,818,975 R661W probably damaging Het
Adam19 T C 11: 46,131,776 C519R probably damaging Het
Adgra3 A T 5: 49,961,309 S966T probably benign Het
Adgrl2 A G 3: 148,823,713 Y1115H probably damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Arhgef17 A C 7: 100,928,924 L939W probably damaging Het
Arhgef18 A G 8: 3,451,629 probably null Het
Cacna1d A C 14: 30,346,841 I147S probably benign Het
Cdc42bpa T G 1: 180,084,433 D525E probably benign Het
Cdh6 T A 15: 13,034,637 I646F probably damaging Het
Col6a5 T G 9: 105,945,544 I205L unknown Het
Ctsc T C 7: 88,309,553 V347A probably damaging Het
Ephb6 A T 6: 41,616,793 T537S possibly damaging Het
Fam135a T C 1: 24,028,585 I168V possibly damaging Het
Fam234b T A 6: 135,209,187 D64E possibly damaging Het
Fgfr2 A T 7: 130,241,240 D157E probably benign Het
Fstl5 A T 3: 76,593,505 I414F possibly damaging Het
Glp2r T C 11: 67,757,531 D115G probably damaging Het
Gpr85 A T 6: 13,836,302 V201D probably damaging Het
Ido1 A C 8: 24,587,778 I91S probably damaging Het
Ism2 G A 12: 87,279,762 P468S probably damaging Het
Map2 A G 1: 66,425,379 K1643E probably damaging Het
Olfr1228 C T 2: 89,249,377 E106K probably benign Het
Olfr1329 A G 4: 118,916,798 V223A probably benign Het
Olfr1466 G A 19: 13,342,065 M102I probably benign Het
Olfr791 C T 10: 129,527,081 P285S probably damaging Het
Ppargc1a A G 5: 51,458,239 probably benign Het
Prpf4b T C 13: 34,894,549 V714A probably damaging Het
Sept8 C T 11: 53,535,982 T190I probably damaging Het
Slc18a2 A G 19: 59,293,843 K494R probably benign Het
Slc34a2 A T 5: 53,069,339 K542N probably damaging Het
Snd1 C A 6: 28,668,601 T429K probably benign Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Timm10b T C 7: 105,641,080 L60P probably damaging Het
Tmprss11a A T 5: 86,411,815 Y373N probably damaging Het
Usp17la T A 7: 104,861,250 V354D probably benign Het
Zbtb7b G T 3: 89,381,319 T64K probably damaging Het
Other mutations in Cpox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Cpox APN 16 58674424 missense possibly damaging 0.87
IGL03031:Cpox APN 16 58672560 missense probably damaging 1.00
IGL03034:Cpox APN 16 58675355 missense probably damaging 0.98
scraggy UTSW 16 58670935 missense probably damaging 1.00
R0413:Cpox UTSW 16 58670869 missense possibly damaging 0.52
R0523:Cpox UTSW 16 58675245 nonsense probably null
R0551:Cpox UTSW 16 58675390 missense probably benign 0.11
R2064:Cpox UTSW 16 58674409 missense probably benign 0.36
R4651:Cpox UTSW 16 58670687 missense possibly damaging 0.92
R4701:Cpox UTSW 16 58677969 nonsense probably null
R4782:Cpox UTSW 16 58672623 missense probably damaging 1.00
R5285:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5287:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5346:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5354:Cpox UTSW 16 58670842 missense probably damaging 0.99
R5404:Cpox UTSW 16 58675286 missense probably damaging 1.00
R5476:Cpox UTSW 16 58678725 missense probably damaging 0.99
R5853:Cpox UTSW 16 58675417 missense probably damaging 0.99
R6026:Cpox UTSW 16 58670935 missense probably damaging 1.00
R7059:Cpox UTSW 16 58670927 missense probably damaging 1.00
R7061:Cpox UTSW 16 58670860 missense possibly damaging 0.76
R7606:Cpox UTSW 16 58674449 missense probably benign 0.16
RF059:Cpox UTSW 16 58670767 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTACGCTTTCCAGAGGAGAGGG -3'
(R):5'- GTCAAGGCTAATGTGCAGATTCC -3'

Sequencing Primer
(F):5'- GCTCGCTGGGCTGTGTAAG -3'
(R):5'- CAGGAGTTACTCACTATAGGACACTG -3'
Posted On2016-07-22