Mutagenetix > Incidental Mutations

Incidental Mutation 'R5313:Slc18a2'

405720

Institutional Source

Beutler Lab

Gene Symbol

Slc18a2

Ensembl Gene

ENSMUSG00000025094

Gene Name

solute carrier family 18 (vesicular monoamine), member 2

Synonyms

Vmat2, 1110037L13Rik

MMRRC Submission

042896-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5313 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59260878-59296012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 59293843 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 494 (K494R)

Ref Sequence

ENSEMBL: ENSMUSP00000026084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026084] [ENSMUST00000099274]

Predicted Effect

probably benign
Transcript: ENSMUST00000026084
AA Change: K494R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094
AA Change: K494R

Domain	Start	End	E-Value	Type
Pfam:MFS_1	22	428	6.8e-40	PFAM
Pfam:Sugar_tr	26	284	5.9e-10	PFAM
Pfam:MFS_2	127	457	4.3e-10	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099274

SMART Domains

Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746

Domain	Start	End	E-Value	Type
transmembrane domain	2	24	N/A	INTRINSIC
low complexity region	75	90	N/A	INTRINSIC
PDZ	374	448	2.02e-10	SMART
low complexity region	582	596	N/A	INTRINSIC
low complexity region	802	814	N/A	INTRINSIC
C1	834	884	8.31e-8	SMART
coiled coil region	1021	1057	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]
PHENOTYPE: Nullizygous mice exhibit early postnatal death accompanied by reduced body size, hypokinesia, and reduced brain monoamine levels. Hypomorphic mutants show impaired olfaction, gastroparesis, altered sleep latency, neuron degeneration, enhanced MPTP sensitivity, anxiety- and depressive-like behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,709,268	E1027K	probably damaging	Het
9130011E15Rik	G	A	19: 45,818,975	R661W	probably damaging	Het
Adam19	T	C	11: 46,131,776	C519R	probably damaging	Het
Adgra3	A	T	5: 49,961,309	S966T	probably benign	Het
Adgrl2	A	G	3: 148,823,713	Y1115H	probably damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Arhgef17	A	C	7: 100,928,924	L939W	probably damaging	Het
Arhgef18	A	G	8: 3,451,629		probably null	Het
Cacna1d	A	C	14: 30,346,841	I147S	probably benign	Het
Cdc42bpa	T	G	1: 180,084,433	D525E	probably benign	Het
Cdh6	T	A	15: 13,034,637	I646F	probably damaging	Het
Col6a5	T	G	9: 105,945,544	I205L	unknown	Het
Cpox	T	A	16: 58,677,948	Y381*	probably null	Het
Ctsc	T	C	7: 88,309,553	V347A	probably damaging	Het
Ephb6	A	T	6: 41,616,793	T537S	possibly damaging	Het
Fam135a	T	C	1: 24,028,585	I168V	possibly damaging	Het
Fam234b	T	A	6: 135,209,187	D64E	possibly damaging	Het
Fgfr2	A	T	7: 130,241,240	D157E	probably benign	Het
Fstl5	A	T	3: 76,593,505	I414F	possibly damaging	Het
Glp2r	T	C	11: 67,757,531	D115G	probably damaging	Het
Gpr85	A	T	6: 13,836,302	V201D	probably damaging	Het
Ido1	A	C	8: 24,587,778	I91S	probably damaging	Het
Ism2	G	A	12: 87,279,762	P468S	probably damaging	Het
Map2	A	G	1: 66,425,379	K1643E	probably damaging	Het
Olfr1228	C	T	2: 89,249,377	E106K	probably benign	Het
Olfr1329	A	G	4: 118,916,798	V223A	probably benign	Het
Olfr1466	G	A	19: 13,342,065	M102I	probably benign	Het
Olfr791	C	T	10: 129,527,081	P285S	probably damaging	Het
Ppargc1a	A	G	5: 51,458,239		probably benign	Het
Prpf4b	T	C	13: 34,894,549	V714A	probably damaging	Het
Sept8	C	T	11: 53,535,982	T190I	probably damaging	Het
Slc34a2	A	T	5: 53,069,339	K542N	probably damaging	Het
Snd1	C	A	6: 28,668,601	T429K	probably benign	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Timm10b	T	C	7: 105,641,080	L60P	probably damaging	Het
Tmprss11a	A	T	5: 86,411,815	Y373N	probably damaging	Het
Usp17la	T	A	7: 104,861,250	V354D	probably benign	Het
Zbtb7b	G	T	3: 89,381,319	T64K	probably damaging	Het

Other mutations in Slc18a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Slc18a2	APN	19	59284384	missense	probably benign	0.02
IGL01956:Slc18a2	APN	19	59287176	splice site	probably benign
IGL02220:Slc18a2	APN	19	59276556	missense	probably benign	0.01
IGL02389:Slc18a2	APN	19	59263301	splice site	probably benign
IGL02795:Slc18a2	APN	19	59274490	splice site	probably benign
PIT4585001:Slc18a2	UTSW	19	59293861	missense	possibly damaging	0.47
R0373:Slc18a2	UTSW	19	59287367	missense	probably benign
R1972:Slc18a2	UTSW	19	59274653	missense	possibly damaging	0.89
R2018:Slc18a2	UTSW	19	59276505	missense	possibly damaging	0.90
R3508:Slc18a2	UTSW	19	59273557	missense	probably benign	0.03
R5574:Slc18a2	UTSW	19	59261405	missense	probably benign	0.09
R6102:Slc18a2	UTSW	19	59293878	missense	probably benign	0.00
R7569:Slc18a2	UTSW	19	59284152	missense	probably damaging	0.96
R7607:Slc18a2	UTSW	19	59284358	missense	probably benign	0.43
R7818:Slc18a2	UTSW	19	59263161	missense	probably benign
R8059:Slc18a2	UTSW	19	59284140	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TTTCTATCTCCAACAGGTACAAGG -3'
(R):5'- ACTCTATGCCAGCAATGGATG -3'

Sequencing Primer
(F):5'- TGAAACTCTCCACTGCGTG -3'
(R):5'- TGGCGTGACTAAGACAGCTC -3'

Posted On

2016-07-22