Incidental Mutation 'R5314:Rprd2'
ID405728
Institutional Source Beutler Lab
Gene Symbol Rprd2
Ensembl Gene ENSMUSG00000028106
Gene Nameregulation of nuclear pre-mRNA domain containing 2
Synonyms6720469I21Rik, 2810036A19Rik, 4930535B03Rik
MMRRC Submission 042897-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R5314 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location95760341-95818863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95764089 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1334 (V1334A)
Ref Sequence ENSEMBL: ENSMUSP00000088297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090791] [ENSMUST00000197501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090791
AA Change: V1334A

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088297
Gene: ENSMUSG00000028106
AA Change: V1334A

DomainStartEndE-ValueType
RPR 26 146 3.6e-29 SMART
Pfam:CREPT 210 351 9.3e-11 PFAM
low complexity region 431 465 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
low complexity region 612 633 N/A INTRINSIC
low complexity region 670 686 N/A INTRINSIC
low complexity region 777 793 N/A INTRINSIC
low complexity region 1159 1179 N/A INTRINSIC
low complexity region 1195 1208 N/A INTRINSIC
low complexity region 1230 1238 N/A INTRINSIC
low complexity region 1272 1295 N/A INTRINSIC
low complexity region 1300 1323 N/A INTRINSIC
low complexity region 1373 1409 N/A INTRINSIC
low complexity region 1446 1467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197501
Predicted Effect unknown
Transcript: ENSMUST00000200164
AA Change: V1250A
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik T C 3: 121,679,523 F109S unknown Het
Ankhd1 A T 18: 36,561,058 probably null Het
Atp8a1 C T 5: 67,705,905 probably null Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc136 G T 6: 29,417,498 V707F probably benign Het
Ccdc157 A T 11: 4,150,078 C91* probably null Het
Ceacam3 T A 7: 17,158,371 N346K possibly damaging Het
Chd4 A G 6: 125,100,588 E74G probably damaging Het
Cntn1 A G 15: 92,295,011 M665V probably benign Het
Crtc2 C T 3: 90,261,041 Q364* probably null Het
Csf1r T A 18: 61,129,724 I857N probably damaging Het
Dner C T 1: 84,580,739 G168D probably damaging Het
Edar T C 10: 58,607,360 T315A probably benign Het
Egflam A G 15: 7,304,012 V153A probably damaging Het
Enoph1 T C 5: 100,063,823 I193T possibly damaging Het
Epc1 A G 18: 6,462,969 I9T probably damaging Het
Fbxw18 T A 9: 109,693,178 I208F possibly damaging Het
Gm4841 A G 18: 60,270,292 V243A probably benign Het
Herc2 T C 7: 56,219,786 V4297A probably damaging Het
Itsn2 C T 12: 4,627,960 P106S probably benign Het
Kcnu1 A G 8: 25,862,458 T218A probably damaging Het
Kif1a A G 1: 93,018,498 S1677P probably damaging Het
Krt14 A T 11: 100,204,700 M293K probably damaging Het
Meis3 T A 7: 16,184,064 V307E probably damaging Het
Nadk2 A C 15: 9,108,313 I417L probably benign Het
Nav2 AAGCAGCAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCAGCAGCA 7: 49,408,692 probably benign Het
Neb A T 2: 52,281,503 N1659K probably benign Het
Olfr1490 T C 19: 13,655,266 V274A probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr951 T C 9: 39,394,489 S233P probably damaging Het
Pde3b A T 7: 114,494,537 N339Y probably damaging Het
Pde8b A G 13: 95,086,853 F298L possibly damaging Het
Phtf1 G A 3: 103,999,287 R606H probably damaging Het
Psd4 A G 2: 24,400,516 D535G possibly damaging Het
Rad51ap1 A G 6: 126,928,158 V130A probably damaging Het
Rbm11 T C 16: 75,596,586 F57L probably damaging Het
Satb2 T C 1: 56,831,527 E433G probably damaging Het
Sema6b G A 17: 56,128,413 R277* probably null Het
Sepsecs A T 5: 52,647,673 S349T probably benign Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Slc7a2 T C 8: 40,915,030 probably null Het
Smc1b T A 15: 85,070,865 Y1062F probably benign Het
Snrnp70 G A 7: 45,377,052 R298* probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Taar8c A T 10: 24,101,348 C189S probably damaging Het
Tas1r2 T A 4: 139,655,361 D103E probably damaging Het
Timd2 T C 11: 46,677,260 I236V probably benign Het
Tmem87a A G 2: 120,377,926 V316A probably damaging Het
Treml2 T A 17: 48,300,573 L16Q probably damaging Het
Wdr66 A G 5: 123,322,563 D1196G probably benign Het
Zcchc14 G A 8: 121,608,598 probably benign Het
Zfp462 T C 4: 55,013,178 Y567H probably damaging Het
Zfp551 G A 7: 12,416,160 R441* probably null Het
Zfp930 A G 8: 69,226,721 I59M probably benign Het
Other mutations in Rprd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Rprd2 APN 3 95765379 missense possibly damaging 0.95
IGL00773:Rprd2 APN 3 95765109 missense probably damaging 1.00
IGL00792:Rprd2 APN 3 95785104 missense probably benign 0.05
IGL01022:Rprd2 APN 3 95763754 nonsense probably null
IGL01121:Rprd2 APN 3 95776550 missense probably damaging 1.00
IGL01299:Rprd2 APN 3 95776547 missense probably damaging 1.00
IGL01387:Rprd2 APN 3 95765319 missense probably benign
IGL01414:Rprd2 APN 3 95765525 missense probably damaging 1.00
IGL02283:Rprd2 APN 3 95765503 missense probably damaging 0.98
IGL02336:Rprd2 APN 3 95787310 missense probably benign 0.17
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0131:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0132:Rprd2 UTSW 3 95774361 missense probably damaging 1.00
R0574:Rprd2 UTSW 3 95774357 missense possibly damaging 0.58
R0718:Rprd2 UTSW 3 95766387 missense probably benign 0.30
R0847:Rprd2 UTSW 3 95765413 missense probably benign 0.00
R0942:Rprd2 UTSW 3 95765418 missense probably damaging 1.00
R0943:Rprd2 UTSW 3 95784247 missense possibly damaging 0.88
R0980:Rprd2 UTSW 3 95765904 missense probably damaging 1.00
R1448:Rprd2 UTSW 3 95818576 missense possibly damaging 0.57
R1542:Rprd2 UTSW 3 95765676 missense possibly damaging 0.69
R1577:Rprd2 UTSW 3 95764735 missense probably damaging 1.00
R1598:Rprd2 UTSW 3 95818739 unclassified probably benign
R1640:Rprd2 UTSW 3 95763747 unclassified probably benign
R1670:Rprd2 UTSW 3 95764803 missense probably damaging 1.00
R2430:Rprd2 UTSW 3 95764795 nonsense probably null
R2966:Rprd2 UTSW 3 95766433 splice site probably null
R3612:Rprd2 UTSW 3 95764152 missense probably damaging 0.98
R3712:Rprd2 UTSW 3 95764560 missense probably damaging 0.97
R3890:Rprd2 UTSW 3 95765224 missense probably damaging 1.00
R4777:Rprd2 UTSW 3 95787374 missense probably benign 0.41
R4783:Rprd2 UTSW 3 95774333 missense probably benign 0.03
R4832:Rprd2 UTSW 3 95774171 missense probably damaging 1.00
R4928:Rprd2 UTSW 3 95764537 missense probably damaging 1.00
R4976:Rprd2 UTSW 3 95766349 missense probably damaging 1.00
R4989:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5134:Rprd2 UTSW 3 95765320 missense probably benign 0.03
R5244:Rprd2 UTSW 3 95790182 missense possibly damaging 0.80
R5579:Rprd2 UTSW 3 95785059 missense probably damaging 1.00
R5954:Rprd2 UTSW 3 95764863 missense probably damaging 1.00
R6016:Rprd2 UTSW 3 95787373 missense probably damaging 0.97
R6332:Rprd2 UTSW 3 95780441 missense probably damaging 0.99
R6403:Rprd2 UTSW 3 95766087 missense possibly damaging 0.77
R6415:Rprd2 UTSW 3 95774219 missense probably benign 0.00
R7064:Rprd2 UTSW 3 95765016 missense probably damaging 1.00
R7313:Rprd2 UTSW 3 95776710 missense probably damaging 1.00
R7496:Rprd2 UTSW 3 95765775 missense probably damaging 1.00
R7535:Rprd2 UTSW 3 95776587 missense probably damaging 0.96
R8716:Rprd2 UTSW 3 95776793 missense probably damaging 1.00
R8822:Rprd2 UTSW 3 95784301 missense probably damaging 1.00
R8891:Rprd2 UTSW 3 95764055 missense possibly damaging 0.85
R8922:Rprd2 UTSW 3 95780584 missense probably damaging 0.99
RF034:Rprd2 UTSW 3 95766320 small deletion probably benign
RF056:Rprd2 UTSW 3 95766319 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTCCCTAGGCCGAAAG -3'
(R):5'- TTACAAAGGAGGCATCTCTGG -3'

Sequencing Primer
(F):5'- TTCCCTAGGCCGAAAGTCTGG -3'
(R):5'- ATCTCTGGCCCACGCTG -3'
Posted On2016-07-22