Mutagenetix > Incidental Mutations

Incidental Mutation 'R0498:Serpinb3a'

40573

Institutional Source

Beutler Lab

Gene Symbol

Serpinb3a

Ensembl Gene

ENSMUSG00000044594

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A

Synonyms

Sqn5

MMRRC Submission

038694-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R0498 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107045587-107052303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107047150 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 218 (F218L)

Ref Sequence

ENSEMBL: ENSMUSP00000108337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027567
AA Change: F218L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: F218L

Domain	Start	End	E-Value	Type
SERPIN	13	387	6.36e-182	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112717
AA Change: F218L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: F218L

Domain	Start	End	E-Value	Type
SERPIN	13	387	6.36e-182	SMART

Meta Mutation Damage Score

0.3620

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.4%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,294	D220V	probably benign	Het
4933406M09Rik	A	G	1: 134,390,872	I461V	possibly damaging	Het
6720489N17Rik	T	C	13: 62,607,387	N39S	probably damaging	Het
Adgrf2	A	G	17: 42,714,315		probably benign	Het
Aldh18a1	A	G	19: 40,574,272	V219A	probably benign	Het
Anapc10	A	G	8: 79,774,981	D126G	probably benign	Het
Ap1m2	T	C	9: 21,295,833	*426W	probably null	Het
Arhgap21	A	G	2: 20,863,117	I865T	probably damaging	Het
Armc8	A	G	9: 99,497,292	V527A	probably damaging	Het
Asic5	A	T	3: 82,006,471		probably benign	Het
Baz2b	A	C	2: 59,901,996		probably benign	Het
Bpifa5	T	C	2: 154,167,249	V237A	probably damaging	Het
Brip1	T	A	11: 86,197,919	K52I	possibly damaging	Het
Cacna1g	T	C	11: 94,459,859	I387V	probably damaging	Het
Cbr4	A	G	8: 61,495,073	I135V	probably benign	Het
Ccdc66	C	T	14: 27,500,240		probably null	Het
Cubn	G	A	2: 13,444,267	T999M	probably damaging	Het
Dpp8	C	T	9: 65,045,795		probably benign	Het
Dsg1b	T	C	18: 20,409,333	S966P	possibly damaging	Het
Erp27	T	C	6: 136,919,864		probably benign	Het
Fat4	A	T	3: 38,980,637	I2813L	probably benign	Het
Fhod1	G	A	8: 105,329,856	R1101C	probably damaging	Het
Hoxc9	T	C	15: 102,983,927	S191P	probably damaging	Het
Izumo4	T	C	10: 80,704,196		probably null	Het
Kalrn	C	T	16: 34,054,891	D104N	possibly damaging	Het
Kank4	A	T	4: 98,779,636	D191E	probably benign	Het
Kbtbd11	A	G	8: 15,027,605	E68G	probably benign	Het
Kdr	C	T	5: 75,959,138	V654I	probably benign	Het
Klra1	A	T	6: 130,372,819		probably null	Het
Kmt2e	T	A	5: 23,478,972	Y373*	probably null	Het
Lepr	A	T	4: 101,745,692	M226L	probably benign	Het
Lrp1b	T	A	2: 41,458,405	I800F	probably benign	Het
Lta4h	T	C	10: 93,471,971		probably benign	Het
Map3k7	T	C	4: 31,974,814		probably benign	Het
Map4k4	G	A	1: 39,990,178	R371Q	probably benign	Het
Mme	A	G	3: 63,346,066	I444V	probably damaging	Het
Mms19	C	T	19: 41,949,773	R582Q	possibly damaging	Het
Mtss1	A	G	15: 58,945,437	S502P	probably damaging	Het
Myo3a	G	T	2: 22,577,429	A232S	possibly damaging	Het
Nwd2	G	T	5: 63,806,343	W1090L	probably damaging	Het
Olfr727	A	C	14: 50,127,293	T239P	probably damaging	Het
Olfr874	G	A	9: 37,746,254	G40E	probably damaging	Het
Pcm1	G	A	8: 41,293,769	S1335N	probably benign	Het
Pdzph1	A	G	17: 58,973,830	F486L	probably benign	Het
Piezo2	T	C	18: 63,102,174	K552R	possibly damaging	Het
Plekhs1	T	A	19: 56,481,104		probably null	Het
Pprc1	C	T	19: 46,071,568	Q1514*	probably null	Het
Ralgapa1	T	C	12: 55,689,791	T1831A	possibly damaging	Het
Rnpep	G	T	1: 135,265,352	D455E	probably damaging	Het
Rpgrip1	T	A	14: 52,131,314		probably benign	Het
Saxo1	A	T	4: 86,478,896	M135K	possibly damaging	Het
Serpina12	T	C	12: 104,035,789	T223A	probably damaging	Het
Serpinb9f	T	G	13: 33,326,007		probably benign	Het
Spata33	A	G	8: 123,221,923	D98G	probably benign	Het
Stard13	T	A	5: 151,052,477	Y742F	probably damaging	Het
Tcrg-C3	T	A	13: 19,261,092	M70K	probably damaging	Het
Tecta	A	G	9: 42,377,614	Y552H	probably damaging	Het
Tie1	A	T	4: 118,479,161		probably benign	Het
Tmem161a	A	G	8: 70,180,973	T254A	probably benign	Het
Tmem30a	G	T	9: 79,774,094	Y264*	probably null	Het
Tmem87a	A	T	2: 120,394,465	I105K	probably benign	Het
Tnrc6b	A	T	15: 80,858,719	D51V	probably damaging	Het
Trpc4	T	C	3: 54,291,211	F519L	probably damaging	Het
Ttn	T	C	2: 76,709,581	T26027A	probably damaging	Het
Vmn1r198	A	C	13: 22,354,974	H121P	probably damaging	Het
Vps33a	A	G	5: 123,570,961	F64L	probably benign	Het
Wdr63	G	T	3: 146,081,364	D305E	possibly damaging	Het
Zfp994	A	T	17: 22,200,901	C356S	probably damaging	Het

Other mutations in Serpinb3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Serpinb3a	APN	1	107051059	nonsense	probably null
IGL01940:Serpinb3a	APN	1	107046185	missense	probably damaging	1.00
IGL02077:Serpinb3a	APN	1	107046381	missense	probably damaging	0.99
IGL02136:Serpinb3a	APN	1	107046285	missense	probably benign	0.15
IGL02214:Serpinb3a	APN	1	107048488	critical splice donor site	probably null
IGL02239:Serpinb3a	APN	1	107051688	missense	probably benign	0.05
IGL02508:Serpinb3a	APN	1	107046072	missense	probably damaging	1.00
IGL02533:Serpinb3a	APN	1	107047162	missense	probably benign	0.00
IGL02860:Serpinb3a	APN	1	107049453	splice site	probably benign
IGL03013:Serpinb3a	APN	1	107046083	missense	probably damaging	1.00
IGL03391:Serpinb3a	APN	1	107046342	missense	possibly damaging	0.81
R0321:Serpinb3a	UTSW	1	107047482	nonsense	probably null
R0416:Serpinb3a	UTSW	1	107049386	missense	probably benign	0.29
R0494:Serpinb3a	UTSW	1	107047482	nonsense	probably null
R1223:Serpinb3a	UTSW	1	107047552	missense	probably damaging	1.00
R1596:Serpinb3a	UTSW	1	107047174	missense	probably benign	0.12
R1655:Serpinb3a	UTSW	1	107046212	missense	probably damaging	1.00
R2156:Serpinb3a	UTSW	1	107047472	critical splice donor site	probably null
R2296:Serpinb3a	UTSW	1	107047561	missense	probably damaging	1.00
R4327:Serpinb3a	UTSW	1	107051770	start codon destroyed	probably damaging	1.00
R4612:Serpinb3a	UTSW	1	107047607	missense	probably damaging	0.99
R4830:Serpinb3a	UTSW	1	107048586	missense	probably benign	0.00
R5016:Serpinb3a	UTSW	1	107046330	missense	probably damaging	1.00
R5483:Serpinb3a	UTSW	1	107047169	missense	probably benign	0.16
R5619:Serpinb3a	UTSW	1	107047108	missense	probably damaging	1.00
R7227:Serpinb3a	UTSW	1	107051629	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTGTGATTCAGGCTGTGTGTAAAA -3'
(R):5'- CCTCAAAACACCTCAGCGTTATGTCTT -3'

Sequencing Primer
(F):5'- TACAGGGTGAGACACAATATCTCC -3'
(R):5'- ACCTCAGCGTTATGTCTTCAAAG -3'

Posted On

2013-05-23