Incidental Mutation 'R5314:Edar'
ID405754
Institutional Source Beutler Lab
Gene Symbol Edar
Ensembl Gene ENSMUSG00000003227
Gene Nameectodysplasin-A receptor
Synonymsanhidrotic ectodysplasin receptor 1, ectodermal dysplasia receptor, ectodysplasin A1 isoform receptor (EDA-A1R), downless (dl), ED1R, ED3, ED5, EDA3
MMRRC Submission 042897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5314 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location58600789-58675654 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58607360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 315 (T315A)
Ref Sequence ENSEMBL: ENSMUSP00000003312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003312]
Predicted Effect probably benign
Transcript: ENSMUST00000003312
AA Change: T315A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000003312
Gene: ENSMUSG00000003227
AA Change: T315A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:TNFR 31 71 2e-16 BLAST
SCOP:d1jmab1 31 91 2e-3 SMART
Blast:TNFR 74 113 5e-20 BLAST
low complexity region 149 169 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
SCOP:d1ngr__ 348 430 2e-4 SMART
low complexity region 439 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor family. The encoded transmembrane protein is a receptor for the soluble ligand ectodysplasin A, and can activate the nuclear factor-kappaB, JNK, and caspase-independent cell death pathways. It is required for the development of hair, teeth, and other ectodermal derivatives. Mutations in this gene result in autosomal dominant and recessive forms of hypohidrotic ectodermal dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce abnormalities of the hair,teeth and some exocrine glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik T C 3: 121,679,523 F109S unknown Het
Ankhd1 A T 18: 36,561,058 probably null Het
Atp8a1 C T 5: 67,705,905 probably null Het
C77080 T C 4: 129,224,212 T208A possibly damaging Het
Ccdc136 G T 6: 29,417,498 V707F probably benign Het
Ccdc157 A T 11: 4,150,078 C91* probably null Het
Ceacam3 T A 7: 17,158,371 N346K possibly damaging Het
Chd4 A G 6: 125,100,588 E74G probably damaging Het
Cntn1 A G 15: 92,295,011 M665V probably benign Het
Crtc2 C T 3: 90,261,041 Q364* probably null Het
Csf1r T A 18: 61,129,724 I857N probably damaging Het
Dner C T 1: 84,580,739 G168D probably damaging Het
Egflam A G 15: 7,304,012 V153A probably damaging Het
Enoph1 T C 5: 100,063,823 I193T possibly damaging Het
Epc1 A G 18: 6,462,969 I9T probably damaging Het
Fbxw18 T A 9: 109,693,178 I208F possibly damaging Het
Gm4841 A G 18: 60,270,292 V243A probably benign Het
Herc2 T C 7: 56,219,786 V4297A probably damaging Het
Itsn2 C T 12: 4,627,960 P106S probably benign Het
Kcnu1 A G 8: 25,862,458 T218A probably damaging Het
Kif1a A G 1: 93,018,498 S1677P probably damaging Het
Krt14 A T 11: 100,204,700 M293K probably damaging Het
Meis3 T A 7: 16,184,064 V307E probably damaging Het
Nadk2 A C 15: 9,108,313 I417L probably benign Het
Nav2 AAGCAGCAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCAGCAGCA 7: 49,408,692 probably benign Het
Neb A T 2: 52,281,503 N1659K probably benign Het
Olfr1490 T C 19: 13,655,266 V274A probably benign Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Olfr951 T C 9: 39,394,489 S233P probably damaging Het
Pde3b A T 7: 114,494,537 N339Y probably damaging Het
Pde8b A G 13: 95,086,853 F298L possibly damaging Het
Phtf1 G A 3: 103,999,287 R606H probably damaging Het
Psd4 A G 2: 24,400,516 D535G possibly damaging Het
Rad51ap1 A G 6: 126,928,158 V130A probably damaging Het
Rbm11 T C 16: 75,596,586 F57L probably damaging Het
Rprd2 A G 3: 95,764,089 V1334A possibly damaging Het
Satb2 T C 1: 56,831,527 E433G probably damaging Het
Sema6b G A 17: 56,128,413 R277* probably null Het
Sepsecs A T 5: 52,647,673 S349T probably benign Het
Slc35b2 T C 17: 45,566,498 Y184H probably damaging Het
Slc7a2 T C 8: 40,915,030 probably null Het
Smc1b T A 15: 85,070,865 Y1062F probably benign Het
Snrnp70 G A 7: 45,377,052 R298* probably null Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Taar8c A T 10: 24,101,348 C189S probably damaging Het
Tas1r2 T A 4: 139,655,361 D103E probably damaging Het
Timd2 T C 11: 46,677,260 I236V probably benign Het
Tmem87a A G 2: 120,377,926 V316A probably damaging Het
Treml2 T A 17: 48,300,573 L16Q probably damaging Het
Wdr66 A G 5: 123,322,563 D1196G probably benign Het
Zcchc14 G A 8: 121,608,598 probably benign Het
Zfp462 T C 4: 55,013,178 Y567H probably damaging Het
Zfp551 G A 7: 12,416,160 R441* probably null Het
Zfp930 A G 8: 69,226,721 I59M probably benign Het
Other mutations in Edar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Edar APN 10 58628638 missense probably damaging 1.00
IGL01551:Edar APN 10 58606038 splice site probably benign
IGL02207:Edar APN 10 58610521 missense probably damaging 0.99
IGL02391:Edar APN 10 58628581 missense probably damaging 0.96
IGL03152:Edar APN 10 58609995 missense possibly damaging 0.88
achtung2 UTSW 10 58603163 missense probably damaging 1.00
two-tone UTSW 10 58603179 missense probably damaging 1.00
ANU23:Edar UTSW 10 58628638 missense probably damaging 1.00
R0113:Edar UTSW 10 58629449 missense probably damaging 1.00
R0413:Edar UTSW 10 58629440 missense probably benign 0.00
R0927:Edar UTSW 10 58629491 splice site probably null
R1217:Edar UTSW 10 58628631 missense probably damaging 1.00
R1458:Edar UTSW 10 58607366 missense probably benign 0.27
R1651:Edar UTSW 10 58606053 missense possibly damaging 0.49
R3820:Edar UTSW 10 58621363 missense probably damaging 1.00
R3932:Edar UTSW 10 58610342 missense probably damaging 1.00
R4050:Edar UTSW 10 58609947 missense possibly damaging 0.74
R4911:Edar UTSW 10 58621324 missense probably benign 0.03
R4924:Edar UTSW 10 58629375 missense probably damaging 1.00
R4998:Edar UTSW 10 58606093 missense probably damaging 1.00
R5311:Edar UTSW 10 58607435 missense possibly damaging 0.68
R5371:Edar UTSW 10 58607452 missense possibly damaging 0.64
R5566:Edar UTSW 10 58628641 missense possibly damaging 0.50
R5847:Edar UTSW 10 58603179 missense probably damaging 1.00
R7330:Edar UTSW 10 58610554 missense probably damaging 0.98
R7529:Edar UTSW 10 58612008 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTAATCAACTCATAGAACCCAC -3'
(R):5'- GAGCTTCACTAACAGGTGCC -3'

Sequencing Primer
(F):5'- CATGAGAGAGTGTGTAACTGCTTAG -3'
(R):5'- CCCTGGTTGTTTCCACAGTGAG -3'
Posted On2016-07-22